Journal of Molecular Biology
Dynamics of Nucleosome Invasion by DNA Binding Proteins
Graphical Abstract
Research Highlights
► Nucleosomal DNA spontaneously unwraps from one end. ► The equilibrium constant for unwrapping decreases with distance inside the nucleosome. ► Proteins bind to unwrapped nucleosomal DNA. ► Unwrapping of the outer stretches of nucleosomal DNA occurs many times per second. ► Unwrapping to sites further inside the nucleosome occurs far more slowly.
Introduction
The large enzyme complexes that carry out replication, transcription, recombination, and DNA repair function on naked DNA substrates, yet most eukaryotic DNAs are wrapped in nucleosomes, which sterically occlude and strongly distort the DNA.1 How these enzyme complexes gain access to their DNA substrates in vivo is not understood. ATP-dependent nucleosome remodeling complexes can help by moving or disassembling nucleosomes,2 creating stretches of naked DNA on which other DNA-binding enzymes can act. What is not understood, however, is how these remodelers themselves “know” which nucleosomes to remodel. The remodelers are recruited to specific chromatin regions through the actions of other site-specific DNA binding regulatory proteins,2, 3, 4, 5 raising a chicken–egg question of how these latter proteins gain access to their own target sites. One potential explanation—that nucleosomes in vivo simply do not cover up critical regulatory target sites—is falsified at over 1000 gene promoters in yeast by the results of genomewide nucleosome mapping studies.6, 7, 8, 9 For example, at the well-studied GAL10–1 locus in yeast, in many cells, a nucleosome centered over the four binding sites for the Gal4 transcription activator protein is occupied by the RSC remodeling complex, leaving the nucleosomes with only ∼ 135 bp of wrapped DNA and potentially facilitating binding by the Gal4 protein.10 However, many other cells in the population have full-length nucleosomes covering this region,7 leaving all Gal4 sites sterically occluded, yet all cells in the population respond appropriately to galactose (L. Chen and J.W., unpublished).
These considerations led us to hypothesize that nucleosomes might not be inert frozen structures, as imaged by X-ray crystallography,1 but instead might be dynamic, such that DNA wrapped in the time average might nevertheless be transiently accessible to other DNA binding proteins. Using biochemical and fluorescence resonance energy transfer (FRET)11 assays, we and others found that nucleosomes are indeed highly dynamic, spontaneously but transiently unwrapping stretches of their DNA starting from one end,12, 13, 14, 15, 16, 17 while the rest of the nucleosome remains fixed in position along the DNA.12, 13 For both isolated nucleosomes and nucleosomes in long arrays,18, 19 the equilibrium constant for such spontaneous “site exposure” near nucleosomal DNA ends is remarkably high at ∼ 0.01–0.1 (i.e., end stretches of nucleosomal DNA are spontaneously unwrapped 1–10% of the time), decreasing progressively with distance inside the nucleosome, down to 10− 5–10− 6 for DNA sites near the middle.14, 20
Spontaneous nucleosomal site exposure is thought to facilitate the ability of RNA polymerase and other processive enzymes to elongate through a nucleosome.16, 21, 22, 23 In addition, it may play a role in photolyase-mediated repair of DNA, which occurs more quickly than can be explained by known ATP-dependent remodeling activities,24 and it may contribute to genomewide transcriptional regulation25, 26 through nucleosome-induced cooperativity.27, 28, 29, 30
In order for such intrinsic nucleosome dynamics to contribute to the real abilities of gene regulatory proteins to gain access to their DNA target sites, it is necessary that site exposure occurs both with an acceptably high probability (equilibrium constant) and with an acceptably high rate. In an initial study,16 we analyzed the dynamics of the ends of wrapped nucleosomal DNA and found that nucleosomes indeed spontaneously open up (partially unwrap their DNA) with a remarkably high frequency, ∼ 4 times per second (i.e., DNA remains fully wrapped for only ∼ 250 ms before spontaneously unwrapping). Once unwrapped, this open state lasts for ∼ 10–50 ms before the DNA spontaneously rewraps. Thus, for regulatory DNA target sites located at short distances inside a nucleosome, the rate of spontaneous nucleosome site exposure is sufficiently great so as to plausibly allow regulatory proteins to find and bind to these sites in vivo.
What happens, however, when a critical regulatory binding site is located further inside a nucleosome, where its equilibrium accessibility is not 1–10% but orders of magnitude lower? This question has not been systematically investigated. Moreover, the isolated data that do exist are complicated by problems of heterogeneous nucleosome positioning and unexpected nucleosome disassembly,31 or by blinking of FRET dyes32, 33 (see Koopmans et al.34). On simple thermodynamic grounds, the greatly reduced equilibrium accessibility measured in our earlier work14, 20 must reflect a decreased unwrapping rate, an increased rewrapping rate, or both. Here, we utilize two independent complementary approaches—stopped-flow FRET and FRET fluorescence correlation spectroscopy (FCS)—to measure the rates of nucleosome unwrapping and rewrapping for differing DNA sites from the end of the nucleosomal DNA inward toward the middle. Our results establish that spontaneous access to sites further inside a nucleosome occurs with greatly reduced rate and lead to new conclusions about the dynamics and mechanisms with which proteins can gain access to nucleosomal DNA target sites in vivo.
Section snippets
Coupled protein binding/FRET assay for position-dependent site exposure
To investigate the position-dependent kinetics of nucleosome site exposure, we take advantage of the steric occlusion of wrapped nucleosomal DNA by coupling site exposure to the binding of a site-specific DNA binding protein. For convenience, we use the LexA repressor protein of Escherichia coli. We construct homogeneously positioned nucleosomes that contain somewhere within their wrapped DNA a specific target site for LexA, such that LexA would “like” to bind to its target site but cannot
Dynamics of position-dependent site exposure
Our major finding is that the rate at which the nucleosomal DNA spontaneously unwraps to make buried DNA target sites accessible for binding decreases dramatically (by orders of magnitude) for target sites located increasingly further inside the nucleosome. The rewrapping rates vary, too, but much less so, and are opposite in direction to what might have been anticipated from the known position-dependent equilibrium constants for accessibility.
The outer stretch of the nucleosomal DNA
DNA, histones, and LexA protein
Cy3-labeled DNA LexA 8–27 (also used as FRET–FCS construct Cy3-1) was prepared exactly as described previously12 using a two-stage PCR procedure. The first stage incorporates a LexA consensus sequence (TACTGTATGAGCATACAGTA) into base pairs 8–27 of the 147-bp “601” nucleosome positioning sequence.12, 38, 39 The second stage incorporates the Cy3 dye into the 5′ end of base pair 1. A commercially synthesized 5′-Cy3-labeled primer is first purified away from an unlabeled primer and free Cy3 by
Acknowledgements
We thank Michael Poirier for help with data analysis, Daniel Grilley and Georgette Moyle for help with preliminary FCS experiments, the Keck Biophysics Facility and Biological Imaging Facility at Northwestern University for the use of instruments, and members of the Widom laboratory for discussions. J.W. acknowledges research support from the National Institutes of Health and the Morris Belkin Visiting Professorship at the Weizmann Institute of Science. H.S.T. acknowledges support from a
References (67)
- et al.
Mechanisms that specify promoter nucleosome location and identity
Cell
(2009) - et al.
A library of yeast transcription factor motifs reveals a widespread function for Rsc3 in targeting nucleosome exclusion at promoters
Mol. Cell
(2008) - et al.
A RSC/nucleosome complex determines chromatin architecture and facilitates activator binding
Cell
(2010) Fluorescence resonance energy transfer and nucleic acids
Methods Enzymol.
(1992)- et al.
Mechanism of protein access to specific DNA sequences in chromatin: a dynamic equilibrium model for gene regulation
J. Mol. Biol.
(1995) - et al.
spFRET using alternating excitation and FCS reveals progressive DNA unwrapping in nucleosomes
Biophys. J.
(2009) - et al.
Spontaneous access to DNA target sites in folded chromatin fibers
J. Mol. Biol.
(2008) - et al.
Sequence and position-dependence of the equilibrium accessibility of nucleosomal DNA target sites
J. Mol. Biol.
(2000) - et al.
Coupled-enzymatic assays for the rate and mechanism of DNA site exposure in a nucleosome
J. Mol. Biol.
(1997) - et al.
Nucleosome transcription studied in a real-time synchronous system: test of the lexosome model and direct measurement of effects due to histone octamer
J. Mol. Biol.
(1996)