Abstract
High temperature requirement A2 (HtrA2/Omi) is a mitochondrial protease that exhibits proapoptotic and cell-protective properties and has been linked to Parkinson's disease (PD). Impaired mitochondrial function is a common trait in PD patients, and is likely to play a significant role in pathogenesis of parkinsonism, but the molecular mechanisms remain poorly understood. Genetic studies in Drosophila have provided valuable insight into the function of other PD-linked genes, in particular PINK1 and parkin, and their role in maintaining mitochondrial integrity. Recently, HtrA2 was shown to be phosphorylated in a PINK1-dependent manner, suggesting it might act in the PINK1 pathway. Here, we describe the characterization of mutations in Drosophila HtrA2, and genetic analysis of its function with PINK1 and parkin. Interestingly, we find HtrA2 appears to be dispensable for developmental or stress-induced apoptosis. In addition, we found HtrA2 mutants share some phenotypic similarities with parkin and PINK1 mutants, suggesting that it may function in maintaining mitochondrial integrity. Our genetic interaction studies, including analysis of double-mutant combinations and epistasis experiments, suggest HtrA2 acts downstream of PINK1 but in a pathway parallel to Parkin.
Similar content being viewed by others
Main
The mammalian HtrA (high temperature requirement) family of proteins show high homology to the bacterial chaperones DegS and DegP.1, 2 DegS, a serine protease, acts as a stress sensor by interacting with unfolded outer membrane porins via its PDZ domain.3 This releases DegS proteolytic activity, triggering a cascade that results in activation of stress response genes via the transcription factor σE. Mammalian HtrA2/Omi, is a mitochondrial protein with both proapoptotic and cell-protective roles.4 Its proapoptotic function is exerted through binding and cleavage of IAPs (inhibitor of apoptosis proteins) on its release into the cytoplasm following a proapoptotic stimulus.5, 6, 7, 8 In Drosophila, HtrA2 has also been reported to be released from the mitochondria on cellular insults such as UV irradiation, and to cleave DIAP1, the principal Drosophila IAP.9, 10, 11
However, genetic data have suggested that mammalian HtrA2, like its bacterial counterpart, normally functions as a stress response gene, preserving mitochondrial integrity. mnd2 (motor neuron degeneration) mice, which have an inactivating mutation in the HtrA2 protease domain, show muscle wasting and neurodegeneration.12 HtrA2 knockout mice have neuronal degeneration in a subset of striatal neurons and exhibit a parkinsonian phenotype, abnormal mitochondria and reduced lifespan.13
In further support of a protective role, growing evidence suggests a link between HtrA2 and Parkinson's disease (PD), a progressive neurodegenerative disorder of unknown aetiology. Two mutant alleles of HtrA2 (A141S and G399S) have been found in PD patients, leading to the classification of HtrA2 as PARK13 by OMIM.14 Although one of these genetic variants was later found in non-PD controls,15, 16 Bogaerts et al.17 identified a new mutation (R404W) in a large cohort of Belgian PD patients, confirming a role for HtrA2 in PD susceptibility. Importantly, recent studies have shown that HtrA2 forms a complex with the PD-related factor PINK1, a mitochondrial-targeted kinase.18 Moreover, HtrA2 is phosphorylated in a PINK1-dependent manner in response to p38 stress-activated protein kinase (SAPK) pathway activation, suggesting that PINK1 can modulate HtrA2 activity as part of mitochondrial stress response. Overexpression studies in flies suggest PINK1 and HtrA2 may be functionally related,19, 20 although their precise relationship remains unclear. We took advantage of Drosophila genetics to examine in vivo the function of HtrA2 in the PINK1 pathway and assess its putative role in apoptosis.
Results
The Drosophila HtrA2 homologue, encoded by CG8464, contains a predicted N-terminal mitochondrial targeting sequence (MTS), a transmembrane domain (TM), a central protease domain, a C-terminal PDZ domain and an unconventional IAP-binding motif (Supplementary Figure S1a).10 HtrA2 encodes a full-length protein of ∼46 kDa. On mitochondrial import, HtrA2 is cleaved to yield two products of 37 and 35 kDa. We have expressed and purified HtrA2 in bacteria and tested its activity towards an HtrA2 fluorescent peptide substrate (H2-Opt) as well as a control peptide as previously described.8 These experiments revealed that HtrA2 efficiently cleaves the H2-Opt substrate but not a control peptide, suggesting that Drosophila HtrA2 has similar substrate specificity to its mammalian homologue (Supplementary Figure S1b).
To address the in vivo function of HtrA2, we generated a mutant allele by imprecise P-element excision of G4907 (Genexel Inc.), which is inserted between HtrA2 and mRpL11 (mitochondrial ribosomal protein-like 11; CG3351; Figure 1a). The G4907 stock is homozygous lethal and could be mutant for either mRpL11 or HtrA2, or for both. We mobilized G4907 and generated a deletion removing 1037 bp from the insertion site to exon 1 of HtrA2 leaving 8 bp of exon 1 (Figure 1a). This allele (HtrA2Δ1) is homozygous lethal and lacks both the transcription and translation start sites of HtrA2, as well as the promoter region and transcription start site of mRpL11, and is therefore likely to be a null allele for both genes. We also recovered a precise excision as a control.
We generated genomic rescue constructs for both HtrA2 and mRpL11 (gHtrA2 and gmRpL11; Figure 1a; Materials and Methods). The lethality of HtrA2Δ1 was rescued by gmRpL11 but not by gHtrA2, indicating that mRpL11 is required for viability, as expected for a ribosomal component. HtrA2Δ1 homozygotes bearing a gmRpL11 rescue transgene represent null alleles solely for HtrA2, indicating HtrA2 is non-essential.
Therefore, to further investigate the phenotypes of HtrA2 mutant flies, we compared flies mutant for HtrA2 and mRPL11 bearing two copies of the gmRpL11 construct (gmRpL11; HtrA2Δ1), which will be referred to as ‘HtrA2Δ1’, with precise excision control flies as a wild type. As an additional control, reversion of phenotypes was tested in flies carrying the HtrA2Δ1 deletion and bearing two copies each of rescue constructs for both mRpL11 and HtrA2 (gmRpL11, gHtrA2; HtrA2Δ1), which will be referred to as ‘HtrA2Δ1 rescued’.
The HtrA2 transcripts are expressed ubiquitously and uniformly in all the tested tissues (Supplementary Figure S2a–f). The precise excision, HtrA2Δ1 and HtrA2Δ1 rescued flies were tested by genomic PCR, RT-PCR and western blot to confirm the deletions and the absence of both transcript and HtrA2 protein in mutants (Figure 1b–d).
Several reports have suggested that HtrA2 can promote apoptosis by cleaving DIAP1, thus releasing the apical caspase Dronc in response to proapoptotic stimuli.9, 10, 11 We therefore monitored cell death using an antibody directed against cleaved Caspase 3 in wing imaginal discs treated with γ-rays (4Gy), staurosporine (STS – 4 μM) and ultraviolet (UV) light (2.5 kJ/m2). Apoptosis induction was identical in control (precise excision) and HtrA2Δ1 mutant discs, both without treatment and on treatment (Figure 2a–f). In addition, the development of HtrA2Δ1 animals is completely normal, in particular, showing normal eye morphology, indicating that HtrA2 is dispensable for retinal apoptosis during development (data not shown). This is consistent with findings in HtrA2 knockout mice13 and suggests that HtrA2 is dispensable for developmental and apoptosis induced by multiple stimuli in vivo.
To determine whether HtrA2 plays a role in maintenance of cellular homoeostasis by the PINK1 pathway, we assessed whether HtrA2Δ1 flies share phenotypic similarities with PINK1 mutants. Drosophila PINK1 mutants exhibit locomotor defects in flight and climbing behaviours, widespread degeneration of indirect flight muscles (IFMs) with accompanying mitochondrial morphology defects, male sterility and partial loss of dopaminergic neurons.21, 22, 23 Strikingly, all these phenotypes are phenocopied in Drosophila mutants of another PD-linked gene, parkin,24, 25, 26, 27 which was shown to act genetically downstream of PINK1.21, 22, 23 Thus, we investigated such phenotypes in HtrA2 mutants.
Myopathology was investigated using toluidine blue staining of IFMs in longitudinal sections of adult thoraces (Figure 3a–c). Although marked myopathology akin to that described in parkin and PINK1 mutants was not observed (in 5- or 30–day-old animals), more detailed investigation will be needed to determine whether Htr2A dysfunction leads to overt myodegeneration. However, examination of IFM ultrastructure from aged HtrA2Δ1 mutants revealed increased numbers of defective mitochondria, displaying reduced electron density and open cristae, compared with wild-type and HtrA2Δ1-rescued controls (Figure 3d–g; Supplementary S3). It should be noted that the mitochondrial abnormalities seen in HtrA2Δ1 mutants are not widespread, suggesting this does not reflect a general mitochondrial defect. To confirm this, we measured mitochondrial activity by high-resolution respirometry in whole flies using 30-day-old males. Coupled mitochondria from WT and HtrA2Δ1 showed no difference in oxygen consumption with substrates of complex I and complex II in the presence of ADP (Supplementary Figure S4a, b). This was confirmed by measuring respiratory activities of complex II and complex IV under uncoupled conditions (Supplementary Figure S4c, d). Thus, there is no systemic mitochondrial deficiency in HtrA2Δ1 mutants compared with controls.
To determine if, like PINK1 and parkin mutants, HtrA2Δ1 mutant flies present locomotor deficits, HtrA2Δ1 mutants were assayed for climbing and flight ability. HtrA2Δ1 mutants showed wild-type flight and climbing ability at 5 days of age (Figure 3h and i). However, 30-day-old HtrA2Δ1 flies show significantly reduced flight and climbing ability compared with wild-type flies. This defect was completely restored in HtrA2Δ1 rescued flies (Figure 3h and i). Thus, the progressive mitochondrial morphological abnormalities seen in HtrA2Δ1 mutants correlate with progressive motor deficits.
In further similarity to parkin/PINK1 mutants, we also find that HtrA2Δ1 males are sterile, whereas female fertility is unaffected. HtrA2Δ1 males are almost completely sterile (4% fertility compared to 100% fertility in control flies; Figure 4a). Importantly, male fertility is restored to wild-type levels in HtrA2Δ1 rescued lines (Figure 4a). However, although PINK1/parkin mutants exhibit distinct morphological defects during spermatogenesis,21, 22, 27, 28 the ultrastructural analysis of HtrA2Δ1 testes revealed no observable defects (Figure 4b). Indeed, mature individualized sperm are formed properly, however, we noted that HtrA2Δ1 sperm were completely immotile, as was the case for PINK1 mutants (see Supplementary movies S1–3 in Supplementary materials).
Recent evidence indicates HtrA2 likely plays a role in cellular stress response mechanisms.18 To test this we determined the effect of loss of HtrA2Δ1 function on longevity and stress resistance. HtrA2Δ1 mutants have a reduced lifespan compared to rescued or precise excision controls (Figure 5a). HtrA2Δ1 flies were also sensitive to paraquat-induced oxidative stress and mitochondrial respiration deficit induced by complex I inhibitor rotenone (Figure 5b and c).
Given the evidence linking HtrA2 to PD, we determined whether the dopaminergic neurons are affected in HtrA2Δ1 flies. Although parkin and PINK1 mutants show age-dependent dopaminergic neuron loss,21, 23, 25 we found 30–day-old HtrA2Δ1 flies showed no difference in number of dopaminergic neurons (Figure 6). However, this is also consistent with the weaker phenotypes in other tissues.
Thus, HtrA2Δ1 mutant flies share a number of phenotypic similarities with parkin/PINK1 mutants, though generally the HtrA2Δ1 phenotypes are weaker. To address whether HtrA2 functions in a common or divergent pathways to PINK1/Parkin, we generated double mutant combinations and determined the effect on climbing ability. Previously, PINK1 and Parkin have been reported to act in a common pathway, consistent with the observation that PINK1:parkin double mutants do not have a more severe phenotype than either of the single mutants.21, 22, 23 Corroborating these findings we find PINK1:parkin double mutants do not show a difference in climbing ability compared to single mutants of either PINK1 or parkin (Figure 7a). Similarly, we find PINK1:HtrA2 double mutants show no difference in climbing ability compared with PINK1 mutants (Figure 7b), consistent with them acting in a common pathway. In contrast, we find that HtrA2:parkin double mutants show a dramatically enhanced climbing defect in comparison to parkin mutants (Figure 7c), suggesting that HtrA2 might act in a different pathway from Parkin. The PINK1 mutant defects are rescued by overexpression of parkin, leading to the suggestion that Parkin acts downstream of PINK1.21, 22, 23 We therefore generated transgenic animals expressing HtrA2 under GAL4/UAS control and tested its ability to rescue PINK1 phenotypes. Interestingly, ubiquitous expression of the HtrA2 transgene significantly rescued the PINK1 climbing defects (Figure 8). Together, these results suggest that HtrA2 likely plays a role in the PINK1 pathway.
Discussion
We have characterized the Drosophila homologue of the HtrA2 protease and found that HtrA2 mutants share some phenotypic characteristics with previously described Drosophila models of PD. HtrA2 null mutants are viable but exhibit mild mitochondrial defects, loss of flight and climbing ability, male infertility, and sensitivity to oxidative stress and mitochondrial toxins (Figures 3, 4, 5 and 6). In contrast, we find that HtrA2 is not required for developmental or stress-induced apoptosis (Figure 2). These data are consistent with findings in mice and humans, which suggest that, HtrA2 functions primarily to maintain mitochondrial integrity and protect cells against oxidative stress,12, 13 and contradicts previous reports that HtrA2 is a proapoptotic factor.9, 10, 11
Recently, Yun et al.20 have reported a characterization of ethanemethylsulphonate-induced alleles of Drosophila HtrA2/Omi. In accordance with our results, they show that HtrA2 is required for male fertility, normal lifespan and stress resistance. They do not report a mitochondrial defect, though the mild nature of the defect observed in our hands and allelic or environmental differences might explain this discrepancy. Both of our reports suggest that HtrA2 mutants have a markedly weaker phenotype than PINK1, which is consistent with the idea that HtrA2 does not play a critical role in the PINK1-Parkin interaction. However, our genetic interaction studies presented here, in conjunction with our previous evidence,19 support the view that HtrA2 acts downstream of PINK1 in a divergent pathway parallel to Parkin.
We have previously shown that a PINK1 overexpression phenotype is partially suppressed by loss of HtrA2, whereas conversely an HtrA2 overexpression phenotype is not suppressed by PINK1 mutations,19 suggesting that HtrA2 functions downstream of PINK1. In a complementary approach using a loss of function phenotype, we show here that overexpression of HtrA2 can partially substitute for loss of PINK1 (Figure 8). These findings are consistent with our previous report and suggest that HtrA2 acts downstream of PINK1. Although the study of Yun et al. did not uncover evidence for HtrA2 acting downstream of PINK1, technical differences, particularly reflecting transgenic expression levels, may account for this discrepancy.
In agreement with Yun et al. we have shown that, similar to PINK1:parkin double mutants, PINK1:HtrA2 double mutants display an identical phenotype to PINK1 mutants alone, suggesting they act in a common pathway (Figure 7). However, we also showed that parkin:HtrA2 double mutants display a stronger phenotype than either mutant alone (Figure 7), suggesting HtrA2 acts in parallel pathway to Parkin. These results are also consistent with our previous findings that loss of either HtrA2 or parkin can partially suppress a PINK1 overexpression phenotype, whereas attenuating both genes together is sufficient to completely suppress the overexpression of PINK1.19 Together these findings support the notion that HtrA2 and Parkin are acting as downstream effectors of PINK1 but in parallel pathways. The relative weakness of the HtrA2 mutant phenotype suggests that it is not the predominant PINK1 effector.
The most pressing questions remain how this pathway is triggered and how its activation leads to protection from mitochondrial stress. By analogy to bacterial DegS, it is possible that the PDZ domain of HtrA2 acts as a sensor for unfolded proteins. In addition, we and others have shown that the mitochondrial protease Rhomboid-7/PARL can process both PINK1 and HtrA2,19, 29 which may represent a regulatory process. Lastly, the p38 SAPK pathway is known to be triggered by reactive oxygen species, which are produced when mitochondrial electron transport is perturbed.30 Mitochondrial dysfunction may therefore modulate HtrA2 activity at several levels. Once activated, HtrA2, like DegS, may cleave unfolded protein and/or elicit a transcriptional response to clear the damaged proteins.4 Further work will be required to fully elucidate the functional relationship between PINK1 and HtrA2, and the involvement of this putative pathway in PD pathogenesis.
Materials and Methods
Drosophila genetics
HtrA2 mutants were created by imprecise excision of P-element G4907 (Genexel Inc.). Breakpoints were mapped by genomic PCR and sequencing. PINK1B9 mutants were a kind gift from J Chung.21 park25 mutants have been described previously.27 All fly experiments were carried out at 25 °C and on the same food batch for each experiment.
For crosses to combine PINK1 mutants with GAL4/UAS transgenes, paternal males with marked X chromosomes (y− or FM6) were used to ensure correct identification of PINK1 mutant progeny.
Fertility assays
Single 1-day-old males of each genotype were individually placed in a vial with three virgin females. The number of vials with larvae was recorded after 5 days.
Flight/climbing assay
Flight/climbing assays were performed as previously described.27 (n⩾30 per genotype, unless otherwise stated within figures.) Statistical significance was calculated by Kruskal–Wallis non-parametric analysis and Dunn's pair-wise comparison.
Longevity assay
A total of 50, 0- to 4-h-old males and females of each genotype were placed into separate vials in groups of 25 for each gender. The flies were transferred to fresh food every 2 days and the number of live flies recorded. Data are presented as Kaplan–Meier survival distributions and significance determined by Log-rank tests.
Oxidative stress assay
The procedure used for longevity assay was repeated for oxidative stress assays using food containing 20 mM paraquat or 20 mM rotenone. Data are presented as Kaplan–Meier survival distributions and significance determined by Log-rank tests.
Molecular biology
RT-PCR
Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). RT-PCR was performed using the kit SuperScript III One-step RT-PCR with Platinum Taq (Invitrogen). The 5′ and 3′ sequences used to amplify the dHtrA ORF are ATGGCTTTGCGCGGTTCC and CTAGGGATCTTCTGGCGTA , respectively. Primers used to amplify 5′ and 3′ dPINK1 ORF are ATGTCTGTGAGACTGCTGAC and CTACGCCACCACATTCTGGA , respectively.
To detect transcripts by RT-PCR in mutants, 5′ primer GTTGTGCCGCTGTCGTCTAT and 3′ primer CGTCGTGCGAAACGTACG were used to amplify a product of 1 kb between exon 2 and exon 3, respectively.
Genomic rescue constructs
The predicted full-length HtrA2 gene, 700 bp of upstream promoter region (including the complete 3′ UTR), was amplified by PCR using 5′ primer CAACTCGAGGAAGTACATTGGGCGGGTC and 3′ primer GGGACTAGTGGGTTTGTCAGCGATTTC , sequenced and subcloned into pCaSpeR-HS using XhoI and SpeI restriction sites. mRPL11 was constructed by including 463 bp of upstream promoter region, the entire predicted gene and 108 bp of downstream genomic region using 5′ primer GGGTCTAGAGCAGCTGATTTCAATTTGGC with XbaI restriction site and 3′ primer GGGGAATTCCACTGGAAAACTCAACAAGC with EcoRI restriction site, sequenced and subcloned into pCaSpeR-HS.
pUASp construct
The dHtrA2 ORF was amplified using 5′ primer TCACGCGGCCGCATGGCTTTGCGCGGTTCC containing NotI restriction site, and 3′ primer ACAGCTCGAGCTAGGGATCTTCTGGCGTA containing XhoI restriction site. The sequenced, digested product was subcloned into pUASp. Western blotting was performed by standard procedures. The anti-HtrA2 antibody (used at 1:1000) was a kind gift from Dr. E. Alnemri (Kimmel Cancer Institute, USA).
Cell biology
Tissue sectioning
Thoraces and testes were prepared from 30- and 2-day-old adult flies, respectively, and fixed overnight in 2% paraformaldehyde, 2.5% gluteraldehyde in sodium cacodylate (0.1 M). Thoraces were rinsed in sodium cacodylate (0.1 M) and 1% tannic acid and postfixed in 1:1 2% OsO4 and sodium cacodylate (0.2 M) for 1 h. After rinsing, thoraces were dehydrated in an ethanol series and embedded using Spurr's resin. Semithin sections were then taken and stained with toluidine blue, whereas ultrathin sections were examined using TEM. Quantification of the mitochondrial phenotype was carried out under blinded conditions for both imaging and analysis. Ten randomly selected fields of view were captured per individual and the number of mitochondria exhibiting a disrupted morphology phenotype and those with normal mitochondria were counted. Approximately 1500 mitochondria were examined per genotype. Pair-wise differences in proportion of mitochondria exhibiting the phenotype were made utilizing the conservative Fisher's exact test.
Dopaminergic neuron counts
Brains were dissected from 30-day-old flies and fixed in 4% paraformaldehyde, rinsed in PBS and incubated with anti-TH antibody (Immunostar Inc., Hudson, WI, USA) in PBS-T BSA (0.5%) overnight (4 °C). After washing with PBS-T, brains were incubated (2 h) with Alexafluor 488 secondary antibody (Invitrogen) in PBS-T BSA (0.5%). After washing, brains were mounted and TH-positive neurons imaged by confocal microscopy. In all cases, TH-positive neurons were counted with the investigator blinded to the genotypes.
Apoptosis assay
Third instar wing imaginal discs were exposed to 4 Gy γ-rays, fixed and stained with anti-caspase 3 after 2 h (Cell Signaling Technologies, Danvers, MA, USA) and FTIC-phalloidin (Sigma, Highland, IL, USA) as previously described.31 For STS (4 μM) and UV treatment (2.5 kJ/m2), larvae were dissected and discs were incubated in Schneider's medium (Invitrogen), then fixed and stained after 4 h. Images were acquired on a Zeiss LSM 510 confocal microscope. The apoptotic index corresponds to the percentage of caspase 3-positive pixels relative to the total area, and was determined as described using Image J.31 For consistency, the analysis was performed on the pouch region of the wing discs.
Abbreviations
- HtrA2:
-
high temperature requirement A2
- PD:
-
Parkinson's disease
- PINK1:
-
PTEN induced putative kinase 1
- IAP:
-
inhibitor of apoptosis protein
- mnd2 :
-
motor neuron degeneration
- SAPK:
-
stress-activated protein kinase
- MTS:
-
mitochondrial targeting sequence
- TM:
-
transmembrane domain
- PDZ:
-
postsynaptic density protein (PSD95), disc large, zonula occludens-1
- H2-Opt:
-
HtrA2 optimal
- mRpL11:
-
mitochondrial ribosomal protein-like 11
- STS:
-
staurosporine
- UV:
-
ultraviolet
- IFM:
-
indirect flight muscle
- WT:
-
wild type
- PARL:
-
presenilin-associated rhomboid-like
References
Clausen T, Southan C, Ehrmann M . The HtrA family of proteases: implications for protein composition and cell fate. Mol Cell 2002; 10: 443–455.
Vaux DL, Silke J . Mammalian mitochondrial IAP binding proteins. Biochem Biophys Res Commun 2003; 304: 499–504.
Sohn J, Grant RA, Sauer RT . Allosteric activation of DegS, a stress sensor PDZ protease. Cell 2007; 131: 572–583.
Vaux DL, Silke J . HtrA2/Omi, a sheep in wolf's clothing. Cell 2003; 115: 251–253.
Srinivasula SM, Gupta S, Datta P, Zhang Z, Hegde R, Cheong N et al. Inhibitor of apoptosis proteins are substrates for the mitochondrial serine protease Omi/HtrA2. J Biol Chem 2003; 278: 31469–31472.
Yang QH, Church-Hajduk R, Ren J, Newton ML, Du C . Omi/HtrA2 catalytic cleavage of inhibitor of apoptosis (IAP) irreversibly inactivates IAPs and facilitates caspase activity in apoptosis. Genes Dev 2003; 17: 1487–1496.
van Loo G, van Gurp M, Depuydt B, Srinivasula SM, Rodriguez I, Alnemri ES et al. The serine protease Omi/HtrA2 is released from mitochondria during apoptosis. Omi interacts with caspase-inhibitor XIAP and induces enhanced caspase activity. Cell Death Differ 2002; 9: 20–26.
Martins LM, Iaccarino I, Tenev T, Gschmeissner S, Totty NF, Lemoine NR et al. The serine protease Omi/HtrA2 regulates apoptosis by binding XIAP through a reaper-like motif. J Biol Chem 2002; 277: 439–444.
Igaki T, Suzuki Y, Tokushige N, Aonuma H, Takahashi R, Miura M . Evolution of mitochondrial cell death pathway: proapoptotic role of HtrA2/Omi in Drosophila. Biochem Biophys Res Commun 2007; 356: 993–997.
Challa M, Malladi S, Pellock BJ, Dresnek D, Varadarajan S, Yin YW et al. Drosophila Omi, a mitochondrial-localized IAP antagonist and proapoptotic serine protease. EMBO J 2007; 26: 3144–3156.
Khan FS, Fujioka M, Datta P, Fernandes-Alnemri T, Jaynes JB, Alnemri ES . The interaction of DIAP1 with dOmi/HtrA2 regulates cell death in Drosophila. Cell Death Differ 2008; 15: 1073–1083.
Jones JM, Datta P, Srinivasula SM, Ji W, Gupta S, Zhang Z et al. Loss of Omi mitochondrial protease activity causes the neuromuscular disorder of mnd2 mutant mice. Nature 2003; 425: 721–727.
Martins LM, Morrison A, Klupsch K, Fedele V, Moisoi N, Teismann P et al. Neuroprotective role of the Reaper-related serine protease HtrA2/Omi revealed by targeted deletion in mice. Mol Cell Biol 2004; 24: 9848–9862.
Strauss KM, Martins LM, Plun-Favreau H, Marx FP, Kautzmann S, Berg D et al. Loss of function mutations in the gene encoding Omi/HtrA2 in Parkinson's disease. Hum Mol Genet 2005; 14: 2099–2111.
Ross OA, Soto AI, Vilarino-Guell C, Heckman MG, Diehl NN, Hulihan MM et al. Genetic variation of Omi/HtrA2 and Parkinson's disease. Parkinsonism Relat Disord 2008; 14: 539–543.
Simon-Sanchez J, Singleton AB . Sequencing analysis of OMI/HTRA2 shows previously reported pathogenic mutations in neurologically normal controls. Hum Mol Genet 2008; 17: 1988–1993.
Bogaerts V, Nuytemans K, Reumers J, Pals P, Engelborghs S, Pickut B et al. Genetic variability in the mitochondrial serine protease HTRA2 contributes to risk for Parkinson disease. Hum Mutat 2008; 29: 832–840.
Plun-Favreau H, Klupsch K, Moisoi N, Gandhi S, Kjaer S, Frith D et al. The mitochondrial protease HtrA2 is regulated by Parkinson's disease-associated kinase PINK1. Nat Cell Biol 2007; 9: 1243–1252.
Whitworth AJ, Lee JR, Ho VM, Flick R, Chowdhury R, McQuibban GA . Rhomboid-7 and HtrA2/Omi act in a common pathway with the Parkinson's disease factors Pink1 and Parkin. Dis Model Mech 2008; 1: 168–174.
Yun J, Cao JH, Dodson MW, Clark IE, Kapahi P, Chowdhury RB et al. Loss-of-function analysis suggests that Omi/HtrA2 is not an essential component of the PINK1/PARKIN pathway in vivo. J Neurosci 2008; 28: 14500–14510.
Park J, Lee SB, Lee S, Kim Y, Song S, Kim S et al. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 2006; 441: 1157–1161.
Clark IE, Dodson MW, Jiang C, Cao JH, Huh JR, Seol JH et al. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 2006; 441: 1162–1166.
Yang Y, Gehrke S, Imai Y, Huang Z, Ouyang Y, Wang JW et al. Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci USA 2006; 103: 10793–10798.
Pesah Y, Pham T, Burgess H, Middlebrooks B, Verstreken P, Zhou Y et al. Drosophila parkin mutants have decreased mass and cell size and increased sensitivity to oxygen radical stress. Development 2004; 131: 2183–2194.
Whitworth AJ, Theodore DA, Greene JC, Benes H, Wes PD, Pallanck LJ . Increased glutathione S-transferase activity rescues dopaminergic neuron loss in a Drosophila model of Parkinson's disease. Proc Natl Acad Sci USA 2005; 102: 8024–8029.
Greene JC, Whitworth AJ, Andrews LA, Parker TJ, Pallanck LJ . Genetic and genomic studies of Drosophila parkin mutants implicate oxidative stress and innate immune responses in pathogenesis. Hum Mol Genet 2005; 14: 799–811.
Greene JC, Whitworth AJ, Kuo I, Andrews LA, Feany MB, Pallanck LJ . Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc Natl Acad Sci USA 2003; 100: 4078–4083.
Riparbelli MG, Callaini G . The Drosophila parkin homologue is required for normal mitochondrial dynamics during spermiogenesis. Dev Biol 2007; 303: 108–120.
Chao JR, Parganas E, Boyd K, Hong CY, Opferman JT, Ihle JN . Hax1-mediated processing of HtrA2 by Parl allows survival of lymphocytes and neurons. Nature 2008; 452: 98–102.
Bradham C, McClay DR . p38 MAPK in development and cancer. Cell Cycle 2006; 5: 824–828.
Colombani J, Polesello C, Josue F, Tapon N . Dmp53 activates the Hippo pathway to promote cell death in response to DNA damage. Curr Biol 2006; 16: 1453–1458.
Acknowledgements
We thank J Chung and the Bloomington Drosophila Stock Center for fly stocks, T Gilbank, S Murray and F Earl for fly transgenics, G Kelly for help with statistical analysis, C Gray for help with movies and K Klupsch for comments on the article. We are grateful to M Guo for sharing data before publication. AW and LT acknowledge the Department of Biomedical Science, Centre for Electron Microscopy for assistance, and the Light Microscopy Facility is supported by the Wellcome Trust (Grant No. GR077544AIA). AW is funded by the Parkinson's Disease Society (G-4063, G-0713) and the Wellcome Trust (081987). The MRC Centre for Developmental and Biomedical Genetics is supported by Grant G070091. LMM is supported by the MRC (UK). Work in the Tapon and Downward laboratories is supported by Cancer Research UK. HPF is supported by the MRC Grant G0700183.
Author information
Authors and Affiliations
Corresponding authors
Additional information
Edited by E Baehrecke
Supplementary Information accompanies the paper on Cell Death and Differentiation website (http://www.nature.com/cdd)
Rights and permissions
About this article
Cite this article
Tain, L., Chowdhury, R., Tao, R. et al. Drosophila HtrA2 is dispensable for apoptosis but acts downstream of PINK1 independently from Parkin. Cell Death Differ 16, 1118–1125 (2009). https://doi.org/10.1038/cdd.2009.23
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/cdd.2009.23
Keywords
This article is cited by
-
Curcuma longa L. Prevents the Loss of β-Tubulin in the Brain and Maintains Healthy Aging in Drosophila melanogaster
Molecular Neurobiology (2022)
-
DNase II mediates a parthanatos-like developmental cell death pathway in Drosophila primordial germ cells
Nature Communications (2021)
-
Apoptosis in Drosophila: which role for mitochondria?
Apoptosis (2016)
-
Compromised MAPK signaling in human diseases: an update
Archives of Toxicology (2015)
-
The protease Omi regulates mitochondrial biogenesis through the GSK3β/PGC-1α pathway
Cell Death & Disease (2014)