Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letter
  • Published:

LARGE glycans on dystroglycan function as a tunable matrix scaffold to prevent dystrophy

Nature volume 503, pages 136–140 (2013)Cite this article

Subjects

Abstract

The dense glycan coat that surrounds every cell is essential for cellular development and physiological function1, and it is becoming appreciated that its composition is highly dynamic. Post-translational addition of the polysaccharide repeating unit [-3-xylose-α1,3-glucuronic acid-β1-]n by like-acetylglucosaminyltransferase (LARGE) is required for the glycoprotein dystroglycan to function as a receptor for proteins in the extracellular matrix2,3. Reductions in the amount of [-3-xylose-α1,3-glucuronic acid-β1-]n (hereafter referred to as LARGE-glycan) on dystroglycan result in heterogeneous forms of muscular dystrophy4. However, neither patient nor mouse studies has revealed a clear correlation between glycosylation status and phenotype5,6. This disparity can be attributed to our lack of knowledge of the cellular function of the LARGE-glycan repeat. Here we show that coordinated upregulation of Large and dystroglycan in differentiating mouse muscle facilitates rapid extension of LARGE-glycan repeat chains. Using synthesized LARGE-glycan repeats we show a direct correlation between LARGE-glycan extension and its binding capacity for extracellular matrix ligands. Blocking Large upregulation during muscle regeneration results in the synthesis of dystroglycan with minimal LARGE-glycan repeats in association with a less compact basement membrane, immature neuromuscular junctions and dysfunctional muscle predisposed to dystrophy. This was consistent with the finding that patients with increased clinical severity of disease have fewer LARGE-glycan repeats. Our results reveal that the LARGE-glycan of dystroglycan serves as a tunable extracellular matrix protein scaffold, the extension of which is required for normal skeletal muscle function.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Muscle generated during Large knockdown is predisposed to aggressive dystrophy.
Figure 2: Regenerating LargeKD muscle has
Figure 3: Increase in α-DG LARGE-glycan chain length during myogenesis enhances ligand-binding capacity.
Figure 4: Reduction in α-DG LARGE-glycan chain length during myogenesis results in NMJ defects.

Similar content being viewed by others

References

  1. Ohtsubo, K. & Marth, J. D. Glycosylation in cellular mechanisms of health and disease. Cell 126, 855–867 (2006)

    Article  CAS  Google Scholar 

  2. Inamori, K. et al. Dystroglycan function requires xylosyl- and glucuronyltransferase activities of LARGE. Science 335, 93–96 (2012)

    Article  ADS  CAS  Google Scholar 

  3. Kanagawa, M. et al. Molecular recognition by LARGE is essential for expression of functional dystroglycan. Cell 117, 953–964 (2004)

    Article  CAS  Google Scholar 

  4. Muntoni, F., Torelli, S., Wells, D. J. & Brown, S. C. Muscular dystrophies due to glycosylation defects: diagnosis and therapeutic strategies. Curr. Opin. Neurol. 24, 437–442 (2011)

    Article  CAS  Google Scholar 

  5. Jimenez-Mallebrera, C. et al. A comparative study of alpha-dystroglycan glycosylation in dystroglycanopathies suggests that the hypoglycosylation of alpha-dystroglycan does not consistently correlate with clinical severity. Brain Pathol. 19, 596–611 (2009)

    Article  CAS  Google Scholar 

  6. Kanagawa, M. et al. Residual laminin-binding activity and enhanced dystroglycan glycosylation by LARGE in novel model mice to dystroglycanopathy. Hum. Mol. Genet. 18, 621–631 (2009)

    Article  CAS  Google Scholar 

  7. Yoshida-Moriguchi, T. et al. O-mannosyl phosphorylation of alpha-dystroglycan is required for laminin binding. Science 327, 88–92 (2010)

    Article  ADS  CAS  Google Scholar 

  8. Hara, Y. et al. Like-acetylglucosaminyltransferase (LARGE)-dependent modification of dystroglycan at Thr-317/319 is required for laminin binding and arenavirus infection. Proc. Natl Acad. Sci. USA 108, 17426–17431 (2011)

    Article  ADS  CAS  Google Scholar 

  9. Michele, D. E. et al. Post-translational disruption of dystroglycan-ligand interactions in congenital muscular dystrophies. Nature 418, 417–422 (2002)

    Article  ADS  CAS  Google Scholar 

  10. Willer, T., Valero, M. C., Tanner, W., Cruces, J. & Strahl, S. O-mannosyl glycans: from yeast to novel associations with human disease. Curr. Opin. Struct. Biol. 13, 621–630 (2003)

    Article  CAS  Google Scholar 

  11. Barresi, R. et al. LARGE can functionally bypass α-dystroglycan glycosylation defects in distinct congenital muscular dystrophies. Nature Med. 10, 696–703 (2004)

    Article  CAS  Google Scholar 

  12. Sato, S. et al. Pikachurin, a dystroglycan ligand, is essential for photoreceptor ribbon synapse formation. Nature Neurosci. 11, 923–931 (2008)

    Article  CAS  Google Scholar 

  13. Brown, S. C. et al. Abnormalities in α-dystroglycan expression in MDC1C and LGMD2I muscular dystrophies. Am. J. Pathol. 164, 727–737 (2004)

    Article  CAS  Google Scholar 

  14. Leschziner, A. et al. Neural regulation of α-dystroglycan biosynthesis and glycosylation in skeletal muscle. J. Neurochem. 74, 70–80 (2000)

    Article  CAS  Google Scholar 

  15. Ibraghimov-Beskrovnaya, O. et al. Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 355, 696–702 (1992)

    Article  ADS  CAS  Google Scholar 

  16. Kobayashi, K. et al. An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy. Nature 394, 388–392 (1998)

    Article  ADS  CAS  Google Scholar 

  17. Jurado, L. A., Coloma, A. & Cruces, J. Identification of a human homolog of the Drosophila rotated abdomen gene (POMT1) encoding a putative protein O-mannosyl-transferase, and assignment to human chromosome 9q34.1. Genomics 58, 171–180 (1999)

    Article  CAS  Google Scholar 

  18. Yoshida, A. et al. Muscular dystrophy and neuronal migration disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev. Cell 1, 717–724 (2001)

    Article  CAS  Google Scholar 

  19. Brockington, M. et al. Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin α2 deficiency and abnormal glycosylation of α-dystroglycan. Am. J. Hum. Genet. 69, 1198–1209 (2001)

    Article  CAS  Google Scholar 

  20. Willer, T., Amselgruber, W., Deutzmann, R. & Strahl, S. Characterization of POMT2, a novel member of the PMT protein O-mannosyltransferase family specifically localized to the acrosome of mammalian spermatids. Glycobiology 12, 771–783 (2002)

    Article  CAS  Google Scholar 

  21. Longman, C. et al. Mutations in the human LARGE gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of α-dystroglycan. Hum. Mol. Genet. 12, 2853–2861 (2003)

    Article  CAS  Google Scholar 

  22. Willer, T. et al. ISPD loss-of-function mutations disrupt dystroglycan O-mannosylation and cause Walker-Warburg syndrome. Nature Genet. 44, 575–580 (2012)

    Article  CAS  Google Scholar 

  23. Cohn, R. D. et al. Disruption of DAG1 in differentiated skeletal muscle reveals a role for dystroglycan in muscle regeneration. Cell 110, 639–648 (2002)

    Article  CAS  Google Scholar 

  24. Beedle, A. M. et al. Mouse fukutin deletion impairs dystroglycan processing and recapitulates muscular dystrophy. J. Clin. Invest. 122, 3330–3342 (2012)

    Article  CAS  Google Scholar 

  25. Kostrominova, T. Y. & Tanzer, M. L. Temporal and spatial appearance of α-dystroglycan in differentiated mouse myoblasts in culture. J. Cell. Biochem. 58, 527–534 (1995)

    Article  CAS  Google Scholar 

  26. Montanaro, F. et al. Laminin and α-dystroglycan mediate acetylcholine receptor aggregation via a MuSK-independent pathway. J. Neurosci. 18, 1250–1260 (1998)

    Article  CAS  Google Scholar 

  27. Barresi, R. et al. LARGE can functionally bypass α-dystroglycan glycosylation defects in distinct congenital muscular dystrophies. Nature Med. 10, 696–703 (2004)

    Article  CAS  Google Scholar 

  28. Osawa, T., Onodera, M., Feng, X. Y. & Nozaka, Y. Comparison of the thickness of basement membranes in various tissues of the rat. J. Electron Microsc. 52, 435–440 (2003)

    Article  Google Scholar 

  29. Buxboim, A., Ivanovska, I. L. & Discher, D. E. Matrix elasticity, cytoskeletal forces and physics of the nucleus: how deeply do cells ‘feel’ outside and in? J. Cell Sci. 123, 297–308 (2010)

    Article  CAS  Google Scholar 

  30. Satz, J. S. et al. Distinct functions of glial and neuronal dystroglycan in the developing and adult mouse brain. J. Neurosci. 30, 14560–14572 (2010)

    Article  CAS  Google Scholar 

  31. Cerletti, M. et al. Highly efficient, functional engraftment of skeletal muscle stem cells in dystrophic muscles. Cell 134, 37–47 (2008)

    Article  CAS  Google Scholar 

  32. Groh, S. et al. Sarcoglycan complex: implications for metabolic defects in muscular dystrophies. J. Biol. Chem. 284, 19178–19182 (2009)

    Article  CAS  Google Scholar 

  33. Valdez, G. et al. Attenuation of age-related changes in mouse neuromuscular synapses by caloric restriction and exercise. Proc. Natl Acad. Sci. USA 107, 14863–14868 (2010)

    Article  ADS  CAS  Google Scholar 

  34. Breloy, I. et al. O-linked N,N′-diacetyllactosamine (LacdiNAc)-modified glycans in extracellular matrix glycoproteins are specifically phosphorylated at subterminal N-acetylglucosamine. J. Biol. Chem. 287, 18275–18286 (2012)

    Article  CAS  Google Scholar 

  35. Kanagawa, M. et al. Disruption of perlecan binding and matrix assembly by post-translational or genetic disruption of dystroglycan function. FEBS Lett. 579, 4792–4796 (2005)

    Article  CAS  Google Scholar 

  36. Harrison, D. et al. Crystal structure and cell surface anchorage sites of laminin α1LG4-5. J. Biol. Chem. 282, 11573–11581 (2007)

    Article  CAS  Google Scholar 

  37. Trendelenburg, A. U. et al. Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size. Am. J. Physiol. Cell Physiol. 296, C1258–C1270 (2009)

    Article  CAS  Google Scholar 

  38. Ervasti, J. M., Ohlendieck, K., Kahl, S. D., Gaver, M. G. & Campbell, K. P. Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature 345, 315–319 (1990)

    Article  ADS  CAS  Google Scholar 

  39. Masaki, T. et al. Expression of dystroglycan complex in satellite cells of dorsal root ganglia. Acta Neuropathol. 101, 174–178 (2001)

    CAS  PubMed  Google Scholar 

  40. Pereboev, A. V., Ahmed, N., thi Man, N. & Morris, G. E. Epitopes in the interacting regions of beta-dystroglycan (PPxY motif) and dystrophin (WW domain). Biochim. Biophys. Acta 1527, 54–60 (2001)

    Article  CAS  Google Scholar 

  41. Gurnett, C. A., Kahl, S. D., Anderson, R. D. & Campbell, K. P. Absence of the skeletal muscle sarcolemma chloride channel ClC-1 in myotonic mice. J. Biol. Chem. 270, 9035–9038 (1995)

    Article  CAS  Google Scholar 

  42. Williamson, R. A. et al. Dystroglycan is essential for early embryonic development: disruption of Reichert’s membrane in Dag1-null mice. Hum. Mol. Genet. 6, 831–841 (1997)

    Article  CAS  Google Scholar 

  43. Hsu, N. Y. et al. Matrix-assisted laser desorption/ionization mass spectrometry of polysaccharides with 2′,4′,6′-trihydroxyacetophenone as matrix. Rapid Commun. Mass Spectrom. 21, 2137–2146 (2007)

    Article  ADS  CAS  Google Scholar 

  44. Colognato, H., Winkelmann, D. A. & Yurchenco, P. D. Laminin polymerization induces a receptor-cytoskeleton network. J. Cell Biol. 145, 619–631 (1999)

    Article  CAS  Google Scholar 

  45. Behrens, D. T. et al. The epidermal basement membrane is a composite of separate laminin- or collagen IV-containing networks connected by aggregated perlecan, but not by nidogens. J. Biol. Chem. 287, 18700–18709 (2012)

    Article  CAS  Google Scholar 

  46. Noakes, P. G., Gautam, M., Mudd, J., Sanes, J. R. & Merlie, J. P. Aberrant differentiation of neuromuscular junctions in mice lacking s-laminin/laminin β2. Nature 374, 258–262 (1995)

    Article  ADS  CAS  Google Scholar 

  47. Han, R. et al. Basal lamina strengthens cell membrane integrity via the laminin G domain-binding motif of α-dystroglycan. Proc. Natl Acad. Sci. USA 106, 12573–12579 (2009)

    Article  ADS  CAS  Google Scholar 

Download references

Acknowledgements

M.M.G. was supported by a NIH/NIAMS Ruth L. Kirschstein National Research Science Award (F32 AR057289-01) and NIH grant (T32-DK07690-16). The work was supported by American Reinvestment and Recovery Act Grant (1RC2NS069521-01), a Muscular Dystrophy Association Research Grant (157538), and a Paul D. Wellstone Muscular Dystrophy Cooperative Research Center Grant (1U54NS053672). F.S. and K.M. were supported by an Intramural Research Grant (23-5) for Neurological and Psychiatric Disorders of NCNP (Ministry of Health and Welfare, Japan) and a MEXT Grant-in-Aid for Scientific Research (C 23591256, 24501357, 25430075). We thank P. Yurchenco for his gift of α1LG4-5 producing cells; J. Levy for microscopy expertise; M. B. Zimmerman for assisting with statistical analysis; R. Crawford for technical expertise; H. Nguyen for illustrations; J. Hartner for oversight of LargeKD mouse targeting; J. Shao and R. Nessler of the University of Iowa Central Microscopy Core for their contributions to imaging; and J. Sanes, G. Valdez, D. Glass, C. Blaumueller and Campbell laboratory colleagues for discussions. K.P.C. is an Investigator of the Howard Hughes Medical Institute.

Author information

Author notes

  1. Biming Wu

    Present address: Present address: Department of Biomedical Engineering, University of Michigan, Ann Arbor, Michigan 48109, USA.,

Authors and Affiliations

  1. Howard Hughes Medical Institute, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, 52242, Iowa, USA

    Matthew M. Goddeeris, Biming Wu, David Venzke, Takako Yoshida-Moriguchi & Kevin P. Campbell

  2. Department of Molecular Physiology and Biophysics, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, 52242, Iowa, USA

    Matthew M. Goddeeris, Biming Wu, David Venzke, Takako Yoshida-Moriguchi & Kevin P. Campbell

  3. Department of Neurology and Neuroscience, Teikyo University School of Medicine, 2-11-1 Kaga, Itabashi-ku, Tokyo 173-8605, Japan,

    Fumiaki Saito & Kiichiro Matsumura

  4. Department of Pathology, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, 52242, Iowa, USA

    Steven A. Moore

  5. Department of Neurology, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, 52242, Iowa, USA

    Kevin P. Campbell

  6. Department of Internal Medicine, Roy J. and Lucille A. Carver College of Medicine, The University of Iowa, Iowa City, 52242, Iowa, USA

    Kevin P. Campbell

Authors
  1. Matthew M. Goddeeris
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Biming Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. David Venzke
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Takako Yoshida-Moriguchi
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Fumiaki Saito
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Kiichiro Matsumura
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Steven A. Moore
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Kevin P. Campbell
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

M.M.G. co-designed the project, carried out the experimental work, analysed and interpreted the data and co-wrote the manuscript. B.W. conducted experimental work and analysed the data. D.V. generated essential reagents. T.Y.-M. generated LARGE-glycan repeat chains and performed binding assays thereon. F.S. and K.M. generated the CAG-Large transgenic mouse model. SA.M. compiled patient biopsies and edited the manuscript. K.P.C. co-designed the project, co-wrote the manuscript and supervised the research. All authors discussed the data and the manuscript.

Corresponding author

Correspondence to Kevin P. Campbell.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Extended data figures and tables

Extended Data Figure 1 Generation of LargeKD mice.

a, GT(ROSA)26Sortm407(H1/tetO-RNAi:Large (LargeKD)-targeted mice were generated at TaconicArtemis GmbH, using an engineered recombinase-mediated exchange acceptor site in the Rosa26 gene, and an exchange vector with the following elements: a neomycin resistance marker; an H1-Tet-On promoter-driven shRNA that targets Large; and a loxP-flanked CAGGS promoter-driven Tet repressor. Mouse embryonic stem cells with the above-described Rosa26 gene were exposed to six distinct doxycycline-inducible/conditional shRNA constructs that target Large. After validation for correct targeting by Southern blotting, the ES cells were evaluated for efficient Large knockdown by qPCR, and for functional loss of IIH6-positive α-DG by western blotting. One knockdown embryonic stem (ES) cell line (targeting the sequence: GGAAGTGCGTGTTCGAGAAGT) was selected for use in blastocyst injections to generate chimaeric mice, on the basis of the efficiency of Large knockdown efficiency therein. Germline animals heterozygous for the knockdown cassette were backcrossed onto a C57BL6/J background. b, shRNA sequence used to target Large. c, d, LargeKD mice and littermate controls. In the absence of doxycycline, the animals are indistinguishable from control littermates both phenotypically (c) and biochemically (d).

Extended Data Figure 2 Reduction in molecular mass of α-DG during and after regeneration and increased adipose staining in LargeKD muscle.

a, b, Western blot analysis of WGA-enriched Triton X-100-soluble homogenates from the tibialis anterior muscles of LargeKD mice 21 (a) and 5 (b) days after CTX injury. Glycosylation of α-DG is ‘re-set’ to a lower molecular mass in the LargeKD (dox+) mice. At 21 days after CTX injury, the contralateral (CL), uninjured LargeKD (dox+) muscle exhibits reduced IIH6 intensity relative to control (dox−), although the molecular mass in the two samples is equivalent. In the 5-day samples, this reduction is not observed, a finding that indicates the loss of reactivity in the 21-day samples is attributable to loss of pre-existing α-DG and failure to replace with IIH6-positive α-DG owing to Large knockdown. At 5 days after injury, a marked increase in molecular mass variation is observed in CTX control tissue (similar to Fig. 3a). c, Haematoxylin and eosin (H&E) analysis reveals evidence of intramuscular adipose cells in LargeKD gastrocnemius muscle 10 days after CTX. d, Staining with the lipophilic dye Oil Red O, confirming that fat is present. Scale bars, 50 μm.

Extended Data Figure 3 Basement membrane abnormalities in LargeKD muscle.

LargeKD muscle at 10 days after CTX. a, Collagen VI and perlecan co-labelling of muscle sections. Arrowheads, lack of perlecan (normal) in endomysial space; arrow, perlecan in the endomysium. b, Secondary only control experiment demonstrating specificity of perlecan signal. c, Line scan intensity analysis for perlecan staining across adjacent myofibres, conducted by a blinded third-party. In the example shown (from a control muscle), increased sarcolemmal/basement membrane staining intensity is observed for the two adjacent myofibres, with minimal staining in the intervening endomysial space. Results of this analysis are quantified in d, e. For perlecan analysis eight line scans were conducted on at least three, ×20 images from 10-day post CTX injury muscles (n = 4 CTX injured mice per group). One-way ANOVA on ranks was used to assess the data. For d and e, **P < 0.001, error bars indicate s.e.m. f, Collagen VI, which is expressed during muscle regeneration, localizes to both the basement membrane and the endomysium in control and LargeKD muscle 10 days after CTX. Laminin α2, which is normally restricted to the basement membrane in control muscle, is also observed in the endomysium of LargeKD muscle (arrows). Arrowhead points to endomysium in control muscle. All images in a, b and f were collected with confocal microscopy, scale bars, 50 μm. g, Quantification of the increase in basement membrane thickness on the basis of transmission electron microscopy of muscle 10 days after CTX injury. Over six images from two LargeKD and three control animals were assessed by a blinded observer using ImageJ software. One-way ANOVA was used to assess the data; **P = 0.001, error bars indicate s.e.m.

Extended Data Figure 4 Expression analysis of LargeKD muscles undergoing regeneration.

RT–PCR-based comparisons of gene expression in CTX and CL tibialis anterior muscles 10 days after injury, for Large (a), Dag1 (b), collagen VIα (Col6a) (c), laminin α2 (Lama2) (d), laminin β1 (Lamb1) (e), perlecan (f) and agrin (g). n ≥ 3 biological repeats and n ≥ 3 technical repeats. The expression of all genes was compared to that for the reference gene Rpl4. Two-way ANOVA was used to analyse the data, and post-hoc comparisons between relevant groups are depicted; *P < 0.05, **P < 0.001, NS, not significantly different; error bars indicate s.e.m.

Extended Data Figure 5 Muscle and basement membrane recovery from CTX injury and cellular hallmarks of C2C12 myogenesis.

a, Serial sections of CTX-injected gastrocnemius muscle stained with haematoxylin and eosin (H&E) and with laminin and collagen antibodies. Existing laminin-containing basement membranes from degenerated myofibres are observable 4 days after CTX treatment. In areas of injury to myofibres (determined by central nucleation of myofibres), laminin and collagen VI are increased in intensity and appear more diffuse than in nearby uninjured regions. Dotted lines demarcate boundaries of damaged regions. Scale bars, 50 μm. CL, contralateral. b, Confluent myoblast cultures stimulated to differentiate by switch to low-serum medium (viewed by phase contrast). Differentiation day (DD) 0 is defined as when C2C12 myoblasts reach confluence in growth medium. 24 h after switching to serum-restricted medium (DD1), the myoblasts are elongated and begin to align with one another. By DD2, myoblast fusion is apparent, and steady myotube growth is observed over the next several days. Scale bars, 100 μm. c, Representative densitometry-based quantification of IIH6-postitive α-DG on DD0 (blue line) and DD5 (black).

Extended Data Figure 6 Expression of α-DG-related genes during C2C12 myogenesis.

qRT–PCR analysis for Pomt1 (a), Pomt2 (b), Pomgnt1 (c), fukutin (d), Ispd1 (e), Tmem5 (f), Sgk196 (g), Ignt1 (h) and α7 integrin (Itga7, i) over the course of C2C12 myogenesis. Although significant changes in expression were observed for some genes, the pattern of expression did not match the increase in molecular mass observed in α-DG, or the increase observed in the expression of Large and Dag1. Biological and technical samples were assessed in triplicate. One-way ANOVA P values are included where significance was found, and time points with significantly increased expression (as determined by post-hoc analysis) are denoted with asterisks. *P < 0.05, NS, not significantly different; error bars indicate s.e.m.

Extended Data Figure 7 Mass spectrometry and binding characteristics of in vitro generated LARGE-glycan repeats and associated binding characteristics of LargeKD α-DG.

a, Mass spectrometry analysis of high- and low-molecular-mass LARGE-glycan repeats using MALDI-TOF MS. High-molecular-mass species are under-represented owing to the difficulty in detecting polysaccharides of greater than 10 kDa using this approach43. b, IIH6 antibody binding to low- and high-molecular-mass LARGE-glycan repeats (error bars indicate s.e.m.). c, Solid-phase binding assay for the perlecan V domain (error bars indicate s.e.m.). d, Dystroglycan in DD4 myotubes generated from isolated primary LargeKD (+ 1 μg ml−1 doxycycline) and control satellite cells was assessed for substrate binding. Solid-phase α1LG4-5 binding demonstrated that binding capacity is dependent on extension of the LARGE-glycan (control Kd = 15.0 ± 5.20 nM; LargeKD Kd = 20.6 ± 3.15 nM). e, Findings for the perlecan V domain were similar to those of α1LG4-5 (control Kd = 4.37 ± 0.749 nM; LargeKD Kd = 4.88 ± 0.846 nM). f, Laminin 111 self assembles, and we wished to test the binding characteristics of a form that is unable to do so. AEBSF-laminin 111 is unable to polymerize yet retains receptor binding capacity44 and when it was tested the differences in binding between LargeKD and control samples were greater than those for laminin 111. This finding indicates that the polymerization of laminin bound to LARGE-glycan reduces the apparent differences in binding between LargeKD and control α-DG (AEBSF-laminin 111 binding control Kd = 7.61 ± 2.12 nM, Bmax = 1.14; LargeKD Kd = 17.1 ± 7.36 nM, Bmax = 0.268). Error bars indicate s.e.m., curve fitting to equation f = Bmax*abs(x)/(Kd + abs(x)).

Extended Data Figure 8 Overexpression of LARGE in a transgenic mouse results in abnormal muscle regeneration.

a, Map of transgene used to generate the CAG-Large transgenic mouse. b, Western blot of α-DG from CL and CTX injured tibialis anterior muscles 4 days after injury, demonstrating that the protein is hyperglycosylated in CAG-Large muscles. c, WGA-enriched samples from CAG-Large muscles 10 days after CTX injury were treated with enzymatic de-glycosylation to remove N-glycans, certain α-DG mucin O-glycans and terminal trisaccharides of O-mannosyl tetrasaccharides while sparing the phosphorylated O-mannosyl-linked LARGE-glycan as evidenced by the maintenance of IIH6-positive α-DG and reduction in molecular mass of β-DG and the IgG present in the samples. d, No change in laminin 111 binding, as detected by solid-phase assay, was observed in glycosidase-treated CAG-Large samples (error bars indicate s.e.m., n = 4 biological replicates) compared to untreated samples indicating that despite Large overexpression, nonspecific LARGE modification is minimal in these muscles. e, f, Haematoxylin-and-eosin-based histological analysis of muscles 10 days after CTX injury revealed an increase in myofibres of small diameter, quantified in g–i. Scale bars represent 200 μm. >6,000 fibres per group were measured, n = 3 animals per group, *P = 0.006, **P < 0.001 by one-way ANOVA; error bars indicate s.e.m.

Extended Data Figure 9 Increased IIH6 reactivity in regenerating myofibres from patients.

a, Western blots of WGA-enriched muscle lysates from patient biopsies. CMD, congenital muscular dystrophy; LGMD2I, limb-girdle muscular dystrophy 2I. b, Patient biopsies were analysed by immunofluorescence for the presence of the α-DG LARGE-glycan (using antibody IIH6) and for signs of regeneration (using antibody to the embryonic myosin heavy chain, eMHC). Increased IIH6 signal correlates with regions of muscle regeneration. In the LGMD2I sample, IIH6 signal is nearly exclusively localized to regions of regeneration. c, Representative immunofluorescence images from patient muscle biopsies. Insets highlight mislocalized (endomysial) perlecan in CMD sample. Intense, localized capillary staining is also observed with perlecan antibody. d, Secondary only staining for perlecan in human dystrophic muscle sample, demonstrating that the signal in c is specific. Scale bars, 100 µm.

Extended Data Figure 10 Model depicting the role of LARGE-glycan in organizing specialized basement membranes.

a, In normal skeletal muscle, LARGE-glycan on α-DG is abundant and forms long chains, providing many binding sites for ligands such as laminin, agrin and perlecan. In addition to binding the LARGE-glycan, perlecan and agrin bind (directly, or indirectly via accessory proteins like nidogen) to laminin and collagen networks, providing collateral linkages as was recently suggested in regards to perlecan45. Increased collateral linkage probably enables compaction of the basement membrane. b, In LargeKD muscle and some dystroglycanopathies, reduced extension of the LARGE-glycan during muscle formation results in a reduction in the number of binding sites for ligands, and the few collateral linkages between collagen, laminin and the sarcolemma are unable to compress the basement membrane. Also, because the basement membrane anchors less collagen, this protein accumulates in the endomysium where it provides ectopic binding sites for perlecan. Agrin is both a high-affinity ligand for the LARGE-glycan and highly concentrated at the NMJ. When the number of LARGE-glycan binding sites at the NMJ basement membrane is limited, agrin saturation of the NMJ may limit the laminin-mediated maturation of the NMJ46. Although DG is depicted as having only two LARGE-glycan chains in this model, it is likely that between 2 and 5 chains are present per DG molecule in skeletal muscle7. Integrins, which are not depicted here, can also bind laminin, and thus could contribute to this network; however, mouse studies indicate that its cellular roles are largely independent of DG47. c, Representative western blot analysis of α-DG in various mouse tissues, demonstrating extensive heterogeneity in molecular mass. Tissues were collected from C57BL6/J mice and samples from multiple mice were pooled before homogenization and Triton X-100 solubilization. Equal amounts of lysate, enriched for glycoprotein by WGA pull down, were loaded. Laminin 111 overlay assay demonstrated that despite differences in molecular mass, the α-DG glycoforms in various tissues retain the capacity to bind laminin. Cb, cerebrum; Cl, cerebellum; E, eye (globe); H, heart; K, kidney; L, lung; n.l., native laminin; SkM, skeletal muscle; T, thymus. d, However, higher molecular mass α-DG species have increased binding capacity for laminin 111, as demonstrated by solid-phase assay, indicating that tissue-specific modification of α-DG LARGE-glycan levels is a possible means to modify cell interactions with the extracellular matrix environment. Error bars indicate s.e.m., curve fitting to equation f = Bmax*abs(x)/(Kd + abs(x)).

PowerPoint slides

Rights and permissions

Reprints and permissions

About this article

Cite this article

Goddeeris, M., Wu, B., Venzke, D. et al. LARGE glycans on dystroglycan function as a tunable matrix scaffold to prevent dystrophy. Nature 503, 136–140 (2013). https://doi.org/10.1038/nature12605

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nature12605

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing