Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Protocol
  • Published:

Isolation and in vitro culture of primary cardiomyocytes from adult zebrafish hearts

Nature Protocols volume 8, pages 800–809 (2013)Cite this article

Subjects

Abstract

This protocol describes how to isolate primary cardiomyocytes from adult zebrafish hearts and culture them for up to 4 weeks, thereby using them as an alternative to in vivo experiments. After collagenase digestion of the ventricle, cells are exposed to increasing calcium concentrations in order to obtain high-purity cardiomyocytes. The whole isolation process can be accomplished in 4–5 h. The culture conditions we established allow the cells to preserve their mature sarcomeric integrity and contractile properties. Furthermore, adult zebrafish cardiomyocytes in culture, similarly to zebrafish in vivo heart regeneration, undergo partial dedifferentiation and, in contrast to their mammalian counterparts, are able to proliferate. Our protocol enables the study of structural and functional properties in close-to-native cardiomyocytes and allows the application of in vitro techniques and assays that are not feasible to perform in living animals.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1
Figure 2: Plating densities of isolated cardiomyocytes.
Figure 3: Morphological characterization of cardiomyocyte cultures over 4 weeks.
Figure 4: Critical steps during cardiomyocyte isolation from zebrafish hearts.
Figure 5: The yield and purity of isolated cardiomyocytes.
Figure 6: Sarcomeric structure and proliferation of cultured cardiomyocytes.
Figure 7: Dividing cardiomyocytes.

Similar content being viewed by others

References

  1. Major, R.J. & Poss, K.D. Zebrafish heart regeneration as a model for cardiac tissue repair. Drug Discov. Today Dis. Models 4, 219–225 (2007).

    Article  Google Scholar 

  2. Kuhl, S.J. & Kuhl, M. Improving cardiac regeneration after injury: are we a step closer? Bioessays 33, 669–673 (2011).

    Article  Google Scholar 

  3. Bersell, K., Arab, S., Haring, B. & Kuhn, B. Neuregulin1/ErbB4 signaling induces cardiomyocyte proliferation and repair of heart injury. Cell 138, 257–270 (2009).

    Article  CAS  Google Scholar 

  4. Engel, F.B. et al. p38 MAP kinase inhibition enables proliferation of adult mammalian cardiomyocytes. Genes Dev. 19, 1175–1187 (2005).

    Article  CAS  Google Scholar 

  5. Jopling, C. et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature 464, 606–609 (2010).

    Article  CAS  Google Scholar 

  6. Kikuchi, K. et al. Primary contribution to zebrafish heart regeneration by gata4+ cardiomyocytes. Nature 464, 601–605 (2010).

    Article  CAS  Google Scholar 

  7. Gonzalez-Rosa, J.M. & Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nat. Protoc. 7, 782–788 (2012).

    Article  CAS  Google Scholar 

  8. Brette, F. et al. Characterization of isolated ventricular myocytes from adult zebrafish (Danio rerio). Biochem. Biophys. Res. Commun. 374, 143–146 (2008).

    Article  CAS  Google Scholar 

  9. Zhang, P.C., Llach, A., Sheng, X.Y., Hove-Madsen, L. & Tibbits, G.F. Calcium handling in zebrafish ventricular myocytes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 300, R56–R66 (2011).

    Article  CAS  Google Scholar 

  10. Louch, W.E., Sheehan, K.A. & Wolska, B.M. Methods in cardiomyocyte isolation, culture, and gene transfer. J. Mol. Cell Cardiol. 51, 288–298 (2011).

    Article  CAS  Google Scholar 

  11. Mitcheson, J.S., Hancox, J.C. & Levi, A.J. Cultured adult cardiac myocytes: future applications, culture methods, morphological and electrophysiological properties. Cardiovasc. Res. 39, 280–300 (1998).

    Article  CAS  Google Scholar 

  12. Grunow, B. et al. In vitro developed spontaneously contracting cardiomyocytes from rainbow trout as a model system for human heart research. Cell Physiol. Biochem. 27, 1–12 (2011).

    Article  CAS  Google Scholar 

  13. Nurmi, A. & Vornanen, M. Electrophysiological properties of rainbow trout cardiac myocytes in serum-free primary culture. Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R1200–R1209 (2002).

    Article  CAS  Google Scholar 

  14. Warren, K.S., Baker, K. & Fishman, M.C. The slow mo mutation reduces pacemaker current and heart rate in adult zebrafish. Am. J. Physiol. Heart Circ. Physiol. 281, H1711–H1719 (2001).

    Article  CAS  Google Scholar 

  15. Jopling, C., Sune, G., Faucherre, A., Fabregat, C. & Izpisua Belmonte, J.C. Hypoxia induces myocardial regeneration in zebrafish. Circulation 126, 3017–3027 (2012).

    Article  Google Scholar 

  16. Jopling, C., Suñe, G., Morera, C. & Izpisua Belmonte, J.C. p38α MAPK regulates myocardial regeneration in zebrafish. Cell Cycle 11, 1195–1201 (2012).

    Article  CAS  Google Scholar 

  17. Frank, J.S., Rich, T.L., Beydler, S. & Kreman, M. Calcium depletion in rabbit myocardium. Ultrastructure of the sarcolemma and correlation with the calcium paradox. Circ. Res. 51, 117–130 (1982).

    Article  CAS  Google Scholar 

  18. Singal, P.K., Matsukubo, M.P. & Dhalla, N.S. Calcium-related changes in the ultrastructure of mammalian myocardium. Br. J. Exp. Pathol. 60, 96–106 (1979).

    CAS  PubMed  PubMed Central  Google Scholar 

  19. Brand, N.J., Lara-Pezzi, E., Rosenthal, N. & Barton, P.J. Analysis of cardiac myocyte biology in transgenic mice: a protocol for preparation of neonatal mouse cardiac myocyte cultures. Methods Mol. Biol. 633, 113–124 (2010).

    Article  CAS  Google Scholar 

  20. Nakagawa, O. et al. Rapid transcriptional activation and early mRNA turnover of brain natriuretic peptide in cardiocyte hypertrophy. Evidence for brain natriuretic peptide as an “emergency” cardiac hormone against ventricular overload. J. Clin. Invest. 96, 1280–1287 (1995).

    Article  CAS  Google Scholar 

  21. Brutsaert, D.L. Cardiac endothelial-myocardial signaling: its role in cardiac growth, contractile performance, and rhythmicity. Physiol. Rev. 83, 59–115 (2003).

    Article  CAS  Google Scholar 

  22. Kikuchi, K. et al. Retinoic acid production by endocardium and epicardium is an injury response essential for zebrafish heart regeneration. Dev. Cell 20, 397–404 (2011).

    Article  CAS  Google Scholar 

  23. Vieira, J.M. & Riley, P.R. Epicardium-derived cells: a new source of regenerative capacity. Heart 97, 15–19 (2011).

    Article  Google Scholar 

  24. Kim, J., Rubin, N., Huang, Y., Tuan, T.L. & Lien, C.L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat. Protoc. 7, 247–255 (2012).

    Article  CAS  Google Scholar 

  25. Hedhli, N. et al. Endothelial-derived neuregulin is an important mediator of ischaemia-induced angiogenesis and arteriogenesis. Cardiovasc. Res. 93, 516–524 (2012).

    Article  CAS  Google Scholar 

  26. Jopling, C., Boue, S. & Izpisua Belmonte, J.C. Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat. Rev. Mol. Cell Biol. 12, 79–89 (2011).

    Article  CAS  Google Scholar 

  27. Porrello, E.R. et al. Transient regenerative potential of the neonatal mouse heart. Science 331, 1078–1080 (2011).

    Article  CAS  Google Scholar 

  28. Huang, C.J., Tu, C.T., Hsiao, C.D., Hsieh, F.J. & Tsai, H.J. Germ-line transmission of a myocardium-specific GFP transgene reveals critical regulatory elements in the cardiac myosin light chain 2 promoter of zebrafish. Dev. Dyn. 228, 30–40 (2003).

    Article  CAS  Google Scholar 

  29. Poss, K.D., Wilson, L.G. & Keating, M.T. Heart regeneration in zebrafish. Science 298, 2188–2190 (2002).

    Article  CAS  Google Scholar 

  30. McCurley, A.T. & Callard, G.V. Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol. Biol. 9, 102 (2008).

    Article  Google Scholar 

  31. Manoli, M. & Driever, W. Fluorescence-activated cell sorting (FACS) of fluorescently tagged cells from zebrafish larvae for RNA isolation. Cold Spring Harb. Protoc. http://dx.doi.org/10.1101/pdb.prot069633 (2012).

  32. Kassen, S.C. et al. The Tg(ccnb1:EGFP) transgenic zebrafish line labels proliferating cells during retinal development and regeneration. Mol. Vis. 14, 951–963 (2008).

    PubMed  PubMed Central  Google Scholar 

  33. Dispersyn, G.D. et al. Dissociation of cardiomyocyte apoptosis and dedifferentiation in infarct border zones. Eur. Heart J. 23, 849–57 (2002).

    Article  CAS  Google Scholar 

  34. Wang, J. et al. The regenerative capacity of zebrafish reverses cardiac failure caused by genetic cardiomyocyte depletion. Development 138, 3421–3430 (2011).

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank A. Raya for help on the protocol, I. Berniakovich and C. Newey for critical reading of the manuscript and C. Fabregat, D. Mulero and J. Vaquero for technical assistance. This work was supported by an INSERM ATIP-AVENIR grant (C.J.). Work in the laboratory of J.C.I.B. was supported by TERCEL-ISCIII-MINECO, Fundacion Cellex, CIBER, The Leona M. and Harry B. Helmsley Charitable Trust and the G. Harold and Leila Y. Mathers Charitable Foundation.

Author information

Authors and Affiliations

  1. Center of Regenerative Medicine in Barcelona, Barcelona, Spain

    Veronika Sander, Guillermo Suñe, Cristina Morera & Juan Carlos Izpisua Belmonte

  2. Département de Physiologie, Centre National de la Recherche Scientifique, Unités Mixtes de Recherche (UMR)-5203, Institut de Génomique Fonctionnelle, Molecular Mechanisms of Regeneration, LabEx Ion Channel Science and Therapeutics (ICST), Institut National de la Santé et de la Recherche Médicale (INSERM), U661, Universités de Montpellier 1 and 2, Montpellier, France

    Chris Jopling

  3. Gene Expression Laboratory, Salk Institute for Biological Studies, La Jolla, California, USA

    Juan Carlos Izpisua Belmonte

Authors
  1. Veronika Sander
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Guillermo Suñe
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Chris Jopling
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Cristina Morera
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Juan Carlos Izpisua Belmonte
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

V.S., C.J. and J.C.I.B. designed the study; V.S., G.S., C.J. and C.M. carried out the experiments; and V.S. and J.C.I.B. wrote the manuscript.

Corresponding author

Correspondence to Juan Carlos Izpisua Belmonte.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Figure 1

Proliferation rate of primary cardiomyocytes. (a) Percentage of BrdU positive cardiomyocytes during the first week of culture. Cells were grown in the presence of 10 μM BrdU, fixed with 4% PFA at the indicated time points, and immunocytologically labelled for Tropomyosin and BrdU. Cells positive for Tropomyosin (as marker for cardiomyocytes), and BrdU were counted using the MetaMorph software. (b) Same experimental approach as in a, comparing the proliferation properties of cardiomyocytes obtained from control hearts to regenerating hearts (7 dpa), in presence and absence of serum. (PDF 258 kb)

Supplementary Figure 2

Viability decline of long term cultures. (a) Primary cardiomyocytes cultured for 5 weeks display a high amount of dead cells (separated, flattened cells, and round cells overlaying the living, network-forming cells; see also Supplementary Video 5). (b) Increase of percentage of dead cells (propidium iodide positive cells) after 10 days of culture. Scale bar, 100 μm. (PDF 302 kb)

Supplementary Figure 3

ANEP staining of cell-cell connections. (a,b) 10-days culture of primary cardiomyocytes. The cells were incubated in 10 μM di-3-ANEPPDHQ (Invitrogen, D36801, diluted in plating medium) for 15 min, washed, and imaged by confocal microscopy. The voltage-sensitive ANEP dye labels the action potential in the sarcolemma of the cardiomyocytes. See corresponding Supplementary Video 6 for contractile behaviour of this culture. Scale bars, 25 μm (a) and 10 μm (a'). (PDF 299 kb)

Supplementary Figure 4

Cardiomyocyte marker expression in purified cells. (a) qPCR measuring gene expression of tissue specific markers, for the myocardium: cmlc2a; endocardium: fli1a; epicardium: wt1b and tcf21; cardiac fibroblasts or immature cardiomyocytes; vim. 18S ribosomal RNA was used for normalization. For the crude cell suspension (red bars), RNA was isolated from the cell pellet after the first wash (step 10), while for the sample of purified cardiomyocytes (green bars) the cell pellet obtained after all 7 washes (step 13) was used. Transcripts of all genes were detected in the crude cell suspension (Ct values displayed on y-axis), while only the normalizer and the cardiomyocyte marker cmlc2a were detectable in the purified sample. (b) Western blot showing a-SA (alpha sarcomeric actin) protein expression in samples obtained from whole zebrafish hearts (lane 1) and from purified cardiomyocytes (lane 2). Protein extracts prepared from purified cardiomyocytes are devoid of unspecific bands. (PDF 259 kb)

Zebrafish qPCR primers used: 18S ribosomal RNA: fwd, TCGCTAGTTGGCATCGTTTATG; rev, CGGAGGTTCGAAGACGATCA34. Cmlc2a (cardiac myosin light chain 2a also named myl7, myosin light polypeptide 7): fwd, GGCTCTTCCAATGTCTTCTCC; rev, GGACTCCAGCTCTTCATCAC. Fli1a (friend leukaemia integration 1a): fwd, CACCGAGGTCCTTCTCTCAC; rev, CTCTCCGTTGGTTCCTTCCC. Wt1b (wilms tumor 1b): fwd, CCACACAGAAATGCCAAATG; rev, GACCCAGCACATCTTGTC. Tcf21 (transcription factor 21): fwd, GTCCAGAGGAACGCTGCTAAC; rev, GTCAGGTTGACGGGATGTATG. Vim (vimentin): fwd, GGAAAAGAGCAAAGTGGAGGT; rev, GATCTGCATCTCAGCAAGTTC.

Supplementary Figure 5

Dedifferentiated cells originate from cardiomyocytes. (a) 7-days culture of primary cardiomyocytes displaying rod shaped cells as well as partially dedifferentiated, flattened cells (arrows). (b) mCherry under the control of the beta-actin promoter remains expressed in dedifferentiated cells, proving their myocardial origin. (c) Overlay of a and b. (d) 14-days culture of cardiomyocytes with advanced dedifferentiation and proliferation, immunocytologically labelled for Tropomyosin, Mef2c, BrdU, and counterstained with DAPI. The arrows point to cells with reduced expression of Tropomyosin, and strong expression of Mef2c, proving their myocardial identity4,33. (e-h) Nuclear DAPI staining overlaps with the Mef2c label in every cell, whereas some of the nuclei did not incorporate BrdU. Scale bars, 25 μm (a) and 100 μm (d). Lineage tracing was performed after crossing tg:cmlc2a-Ert2CreErt2 to tg:(eab2:[EGFP-T-mCherry]) zebrafish5. Driven by the beta-actin promoter, the F1 fish are ubiquitously GFP positive. Upon treatment with 4-hydroxy tamoxifen, the cardiomyocytes specifically (due to the cmlc2a promoter driving Cre expression) convert to expressing mCherry. Tamoxifen was injected to adult zebrafish 2 weeks before cardiomyocyte isolation. Cells were cultured for one week until they started to dedifferentiate and divide. Transgene expression was examined in live cells. Due to the beta-actin promoter controlling expression of the mCherry cassette, transgene expression does not get turned off upon dedifferentiation, as is the case in cmlc2a-driven fluorescent tags. (PDF 334 kb)

Supplementary Figure 6

Transfection of primary cardiomyocytes. 0.4 μg pCS+ nlsGFP were transfected with 1 μl Lipofectamine 2000 in Opti-MEM into cardiomyocytes plated 1 day prior to transfection on poly-L-lysine in medium density. The medium was changed after 24 h, and transfection efficiency was examined after 48 h. Scale bars, 100 μm (a) and 50 μm (b). (PDF 272 kb)

Supplementary Table 1

Conditions tested for optimal tissue digestion. (PDF 247 kb)

Supplementary Table 2

Analysis of various parameters for isolation and culture of primary cardiomyocytes. (PDF 286 kb)

Supplementary Table 3

Flow cytometric analysis of yield and purity. (PDF 238 kb)

Supplementary Video 1

Advanced culture of primary cardiomyocytes. 4 weeks after plating, partially dedifferentiated cells can be seen connected to mature rod shaped cardiomyocytes. The whole culture contracts synchronously. (MOV 4522 kb)

Supplementary Video 2

Loss of sarcomeric GFP expression in a 2-weeks culture. Mature cardiomyocytes isolated from cmlc2a:GFP transgenic zebrafish strongly express GFP. Upon dedifferentiation, the sarcomeric apparatus (including cardiac myosin) disassembles, as can be seen by diminishing GFP expression in non-beating cells of flattened shape. (MOV 2722 kb)

Supplementary Video 3

2-days cardiomyocyte culture on fibrin gel. As early as 2 days after plating the cells have formed a network structure and have started beating. (MOV 1658 kb)

Supplementary Video 4

1-week culture of primary cardiomyocytes. The cells have formed network-like connections and started to contract. (MOV 3459 kb)

Supplementary Video 5

Viability decline in long term culture. 5 weeks after plating, the cells contract less frequently and the number of dead cells is increased (see also Supplementary Fig. 2). (MOV 2352 kb)

Supplementary Video 6

10-days culture of primary cardiomyocytes used for ANEP staining. A network of differentiated, spindle-shaped and strongly contracting cells and partially dedifferentiated cells (characterized by their flattened shape and passive beating motion, visible in the centre of the field) has formed. The corresponding pictures showing cell-cell connections by ANEP staining in overview and high magnification are presented in Fig. 3g,g' and Supplementary Fig. 3. An example of a dead cardiomyocyte of elongated appearance with punctuated structures, which is moved only by the underlying live cells, is visible on the right hand side of the culture. (MOV 1447 kb)

Supplementary Video 7

2-weeks culture of primary cardiomyocytes. Flattened, partially dedifferentiated cardiomyocytes are spread out between actively beating mature muscle cells. Mature and dedifferentiated cardiomyocytes remain connected. (MOV 1207 kb)

Supplementary Video 8

Lineage tracing of partially dedifferentiated cells. Expression of mCherry in partially dedifferentiated, flattened cells demonstrates their myocardial origin (see also Supplementary Fig. 5). (MOV 452 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Sander, V., Suñe, G., Jopling, C. et al. Isolation and in vitro culture of primary cardiomyocytes from adult zebrafish hearts. Nat Protoc 8, 800–809 (2013). https://doi.org/10.1038/nprot.2013.041

Download citation

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nprot.2013.041

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing