Abstract
Bacteria in nature often reside in differentiated communities termed biofilms, which are an active interphase between uni-cellular and multicellular life states for bacteria. Here we demonstrate that the development of B. subtilis biofilms is dependent on the use of glutamine or glutamate as a nitrogen source. We show a differential metabolic requirement within the biofilm; while glutamine is necessary for the dividing cells at the edges, the inner cell mass utilizes lactic acid. Our results indicate that biofilm cells preserve a short-term memory of glutamate metabolism. Finally, we establish that drugs that target glutamine and glutamate utilization restrict biofilm development. Overall, our work reveals a spatial regulation of nitrogen and carbon metabolism within the biofilm, which contributes to the fitness of bacterial complex communities. This acquired metabolic division of labor within biofilm can serve as a target for novel anti-biofilm chemotherapies
Similar content being viewed by others
Introduction
Despite the widely held view of bacteria as unicellular organisms that struggle for individual survival, in nature, bacteria establish complex communities, referred to as biofilms. Biofilm are differentiated communities, where the inhabitant cells are held together by an organic extracellular matrix1,2,3 and biogenic minerals4,5,6. In a biofilm, cells use a variety of mechanisms to coordinate activity within the community, as well as across species7,8. In many instances, biofilms provide beneficial effects to other organisms, e.g., biocontrol agents form biofilms on the surface of plant roots to prevent the growth of bacterial and fungal pathogens9,10,11,12. In other situations, biofilms can have deleterious effects; in a clinical context, biofilms are inherently resistant to antimicrobial agents, and are at the core of many persistent and chronic bacterial infections13. Thus, gaining insights into microbial sociology and biofilm formation, will potentially provide significant clinical13,14, technological15,16,17, agricultural10,18 and ecological19,20,21 advancements.
The Gram-positive bacterium Bacillus subtilis is a robust biofilm former, and can form a structured biofilm colony comprised of cells encapsulated by a thick extracellular matrix on a solid–air interface7,22. The resultant colony morphology is considered a direct readout for differentiation and extracellular matrix production22,23,24.
So far we and others uncovered several cues that have been associated with biofilm colonies maturation and assembly, including depravation of oxygen and trace elements25,26,27,28,29, small molecule sensing30,31,32, calcium6,33, and physical signals34,35,36,37. And yet, there are other developmental cues awaiting to be discovered.
Although derived from a single genetically identical clone, bacteria within mono-species biofilms are heterogeneous in terms of metabolism, gene expression and physiology, creating diverse biological niches within the biofilm7,38. This heterogeneity facilitates response to changing environmental conditions, allowing survival and growth of the biofilm community39,40. With time, multiple division events take place, the biofilm thickens, and the founder population generates the inner cell mass, while the dividing cells tend to be localized to the edges41,42. The differential metabolic activities of the cells in the inner mass, periphery and transition areas result in concentration gradients of nutrients. As a result, cells that are growing in the different areas of the biofilm become very distinct from each other. As biofilm development proceeds, its survival requires the establishment of complex spatial associations between the periphery and inner cells41. Several recent findings linked the development of bacterial multicellular communities with the metabolism of glutamine and glutamate in the Gram-positive bacterium B. subtilis26,37,43,44. Glutamine is a nonessential and abundant amino acid which can be converted to ammonia and glutamate, providing an important source of carbon and nitrogen for the synthesis of nucleic acids, amino sugars, and proteins. Glutamine can be acquired from the growth media or generated by glutamine synthase from glutamate and ammonia. Recently it was shown that in the biofilm, glutamate is up taken from the medium by the peripheral cells while only the inner cells have the ability to synthesize ammonia43. This co-dependence between the peripheral and central cells for glutamine synthesis gives rise to metabolic commensalism; the peripheral cells growth is restricted so that they cannot consume all the glutamate and starve the inner cells, because they depend on the inner cells to synthesize ammonia for glutamine synthesis. In parallel, glutamate dehydrogenase paralogous GudB and RocG which catalyze glutamate, contribute to the fitness of biofilm cells and interference with their transcriptional regulation has deleterious effects44. While both glutamine and glutamate were shown to be important to biofilm fitness, their specific contribution to biofilm development remains to be determined. Specifically, it is still unknown whether they provide mainly carbon, nitrogen, or both. Here we systematically explore the metabolic contributions of glutamate and glutamine to biofilm development for translational and therapeutic applications.
Materials and Methods
Strains
Experiments were performed with Bacillus subtilis NCIB 361022 and its indicated derivatives, Enterococcus faecalis 2921245, and Pseudomonas aeruginosa PA0146.
Construction of strains
Laboratory strains B. subtilis PY79 and E. coli DH5α were used for cloning purposes. Transformation of B. subtilis PY79 with linearized plasmid or PCR products, was performed as previously described47.
For P glnRA fusions to GFP and LacZ we used the following primers: a forward primer GATCGAATTCATTTTTAAAATTTCTCTGGATTG, and a reverse primer: TGCGAAGCTTGGTAAAATTCCTCCTCTTAA. For P ldh fusion to GFP we used the following primers: a forward primer GTGTGAGAATTCAGTTTTGTTAAAAGAGATCCAGCG, and a reverse primer: TGC GTCAGTAAGCTTCATTAATCATCCTTGCAGGGT.
The plasmid pYC12148 which contains a functional GFP gene and a chloramphenicol resistance gene was used as a template for the construction of GFP reporter strains. The plasmid pDG172849 which contains a functional β-galactosidase gene and a spectinomycin resistance gene was used as a template for the construction of LacZ reporter strains. PCR fragments were amplified from NCIB 3610 chromosomal DNA, using primers with the suitable restriction sites for ligation into the plasmid. The ligated plasmids were then transformed into E. coli DH5α and ampicillin resistant colonies were selected and confirmed by sequencing. The reporters were then integrated into the neutral amyE locus of strain NCIB 3610 by transformation, as described above, and selected for antibiotic resistance. Strains carrying tnrA deletion and the P ldh -lacZ were generated by us previously from the parental strain NCIB 361026,27.
Growth media
The strains were routinely manipulated in biofilm medium, containing MS salts and 125 µM FeCl326, either with glycerol and glutamate (MSgg26) or as indicated in each figure legend. When grown anaerobically, a nitrate source (KNO3) was added to the medium as previously described27. The solid medium contained 1.5% bacto agar (Difco).
Biofilm development assay
A single B. subtilis colony, isolated on solid LB plates, was used to inoculate 3 ml LB broth starter culture and grown to mid-logarithmic phase at 37 °C. Then, a 2 μL drop of the culture was spotted on MSgg-nitrate solid medium. Plates were incubated at room temperature. Images and GFP signal intensity were obtained with a Stereo Discovery V20″ microscope with Objective Plan Apo S 0.5xFWD 134 mm or Apo S 1.0x FWD 60 mm (Zeiss) attached to an Axiocam camera. Data were analyzed using Axiovision suite software (Zeiss).
Biofilm imaging
To grow biofilms, 1.5 µl of starter culture was inoculated on plates of solid MSgg medium that were dried in a biological hood for 45 min prior to inoculation. Plates were grown at 30 °C. Photos of colonies were acquired with a NikonD800 camera or a stereomicroscope (Zeiss) and images were optimized for contrast and brightness using Adobe Photoshop.
β-galactosidase assay
Biofilms were grown on solid MSgg medium as indicated. The colonies were collected, resuspended in 1 mL PBS, and sonicated to remove the extracellular matrix (BRANSON digital sonifier, Model 250, Microtip, amplitude 20%, pulse 3x 5 sec). OD600 had been measured (Ultrospec 2100, Amersham Biosciences. Cells (108–109) were taken for the assay. Cells were spun down, and pellets were resuspended in 1 mL of Z buffer (40 mM NaH2PO4, 60 mM Na2HPO4, 1 mM MgSO4, 10 mM KCl, 38 mM β-mercaptoethanol) supplemented with 200 μg mL−1 freshly made lysozyme. The samples were incubated for 15 min at 30 °C. Reactions were started by adding 200 μL of 4 mg mL−1 ONPG (2-nitrophenyl β-D-galactopyranoside) and stopped by adding 500 μL of 1 M Na2CO3. The soluble fractions were transferred to cuvettes (VWR), and OD420 values of the samples were recorded using a Pharmacia Ultraspectrometer 2000. The β-galactosidase-specific activity was calculated according to the equation [(OD420/(time × OD600)] × dilution factor × 1000. Time represents the time follwing the addition of ONPG. Assays were conducted in triplicates. For anaerobic growth and anoxic growth, biofilms were grown in anaerobic chamber or by the candle jar method50 in the presence of (KNO3)27,51.
Crystal violet essay
To grow biofilms, 1.5 µl of starter culture was inoculated into TSB (Difco) (for P. aeruginosa) or TSB-Glucose media (for E. faecalis) in 96 well polystyrene plates either with or without AOA and DON. Plates were treated later as discussed in the corresponding figure legend. Crystal violet assay (Sigma) was performed as described previously52.
Gas chromatography/mass spectrometry (GC/MS)
Biofilm cells were collected from three independent colonies, from the periphery and center, as previously described26. Cells were mildly sonicated to remove the extracellular matrix portion, and the optical density (OD600) of the collected fraction was measured. Cells were then washed with ice cold saline and lysed with 50% methanol in water followed by three freeze thaw cycles in liquid nitrogen. The insoluble material was pelleted in a cooled centrifuge (4 °C) and the supernatant was collected for subsequent GC-MS analysis. Samples were dried under air flow at 42 °C using Techne Dry-Block Heater with sample concentrator (Bibby Scientific Limited, UK). Dried samples were treated with 40 μl methoxyamine hydrochloride solution (20 mg/ml in pyridine) at 37 °C for 90 min while shaking, followed by incubation with 70 μl N, O-Bis (trimethylsilyl) trifluoroacetamide (Sigma) at 37 °C for additional 30 min. The samples were centrifuged and allowed to stand at room temperature for 2 hours before injection. The results were normalized to ribitol as an internal standard and to the OD600 absorption of each sample. GC/MS analysis was performed using a gas chromatograph (7820AN, Agilent Technologies, USA) interfaced with a mass spectrometer (5975 Agilent Technologies, USA). A HP-5ms capillary column 30 m × 250 µm × 0.25 µm (19091S-433, Agilent Technologies, USA) was used. Helium carrier gas was maintained at a constant flow rate of 1.0 mL min−1. The GC column temperature was programmed from 70 to 150 °C via a ramp of 4 °C min−1, 150–215 °C via a ramp of 9 °C min−1, 215–310 °C via a ramp of 25 °C min−1 and maintained at 310 °C for additional 5 min. The MS was done by electron impact ionization and operated in full scan mode from m/z, 30–500. The inlet and MS transfer line temperatures were maintained at 250 °C and 310 °C, respectively. The ion source temperature was 280 °C. Sample injection (1–3 μL) was in splitless mode.
Planktonic growth analysis
Cells were diluted 1:100 in 150 µl liquid MSgg medium of each well of a 96-well plate (Thermo Scientific). Cells were grown with agitation at 30 °C for 12 hours in a microplate reader (Synergy 2, BioTek), and the optical density at 600 nm (OD600) was measured every 30 min. Cells were grown in a relevant growth medium as indicated in the corresponding figure legend.
Cell density analysis of biofilms
To determine culture density of cells grown in biofilm colonies, cells were harvested from a biofilm colony (described above), and thoroughly vortexed. Untreated wild type cells were mildly sonicated (BRANSON digital sonifier, Model 250, Microtip, amplitude 20%, pulse 3x 5 sec). Optical density OD600 was measured with a spectrophotometer (Ultrospec 2100, Amersham Biosciences).
Biofilm cells regrowth analysis
To evaluate regrowth of different subpopulations we harvested the biofilm cells from the center and the edges of a single colony into 500 µL of PBS solution (see Fig. S1) and performed mild sonication in BRANSON digital sonifier, Model 250, Microtip, amplitude 20%, pulse 3x 5 sec),as described previously30,53,54,55, and diluted to equivalent cell numbers in PBS. Experiments were performed with at-least three technical repeats (three individual colonies). To avoid bias we started all the experiments with equivalent number of cells from either the center or the edge (OD = 0.005) in the indicated growth media.
Results
Glutamine and glutamate are important nitrogen and carbon sources for most multicellular organisms56. Thus, we first evaluated the necessity of both glutamine and glutamate for bacterial biofilm development by measuring biofilm maturation, biomass and planktonic growth, following supplementation of different nitrogen sources to the biofilm defined media. In the traditional biofilm defined medium which contains glutamate or glutamine as the primary nitrogen source, we found that B. subtilis wild type strains form an almost perfect circular biofilm shape, characterized by thick branching wrinkles that surround a defined circular center with smaller, more delicate, and denser creases (Fig. 1A upper panel). However, medium with neither of these two metabolites led to no biofilm development, while nitrogen salt supplementation, resulted in less mature biofilm formation, lacking pronounced wrinkles and ridges (Fig. 1A lower panels). Interestingly, this requirement was specific for biofilm development, as all three nitrogen sources were sufficient to sustain planktonic growth (Fig. 1B).
In the biofilm, glutamine levels are regulated by the activity of TnrA57,58,59. As expected from our findings, mutating tnrA led to a developmental defect in biofilms of B. subtilis without affecting planktonic growth (Figs 1C and S2). To test whether the induced defect in TnrA altered the ability of the biofilm to utilize glutamine, we grew the wild type its tnrA mutant derivative, with medium containing high levels of glutamine. In the presence of high concentration of glutamine, the tnrA mutant made a rouges colony enriched with small dense wrinkles, comparable to the parental strain grown under the same conditions (Fig. 1C). This clear inability of tnrA to develop a mature colony in the absence of glutamine suggests that cells depend on TnrA for glutamine synthesis, further correlating glutamine availability with transcription regulation and highlighting its role biofilm development.
To test whether nitrogen contributes to biofilm formation more than carbon, we tested whether a transition between non-favorable carbon source (glycerol) and favorable carbon sources (fructose and glucose)60 in minimal media has a similar effect on biofilm development. In contrast to the effects of different nitrogen sources on biofilm development shown in Fig. 1A,B, we found that alterations of the carbon sources had more subtle effects on colony morphology, and yet dramatically affected planktonic growth (Fig. 1D,E). These results together suggest that while the biofilm development depends on the specific source of nitrogen, planktonic growth depends more on the availability and source of carbon.
To distinguish between the contribution of glutamine and glutamate to biofilm development, we used two inhibitors for glutamine and glutamate synthesis 6-Diazo-5-oxo-L-norleucine (DON)61, a glutamine analogue, and aminooxyacetic acid (AOA), an inhibitor of glutamate oxaloacetate transaminase and aspartate aminotransferase, which restricts glutamate and its downstream metabolites’ levels62,63. These drugs are used for cancer therapy as most cancer cells depend on glutamine for growth64, but were also suggested to affect bacterial planktonic growth, and nitrogen metabolism61,62. Based on our findings described here for the similar biofilm dependence on glutamine and glutamate, we hypothesized that these drugs would inhibit biofilm development.
We measured the effects of these inhibitors on planktonic growth and on the biofilm biomass as a quantifiable readout for biofilm formation65,66. We found that the glutamine competitor DON at 100 nM concentration had little or no effect on planktonic growth and yet dramatically decreased the biomass of biofilm colonies (Fig. 2A,B). At the same dosage, AOA, acting downstream to glutamine and restricting glutamate levels, was extremely toxic to bacterial planktonic cultures (Fig. 2C), and affected the biofilm’s biomass growth more severely than DON (Fig. 2C,D). At the lower concentration (10 nM), both DON and AOA had no detectable effect on planktonic growth while AOA diminished biofilm biomass growth. These results support the dependence of the biofilm growth on glutamine and glutamate, as compared to planktonic growth. Moreover, biofilms that formed in the presence of sub-inhibitory concentrations of DON and AOA, were compromised in their formation of complex morphology, demonstrating a higher sensitivity to AOA (Fig. 2E). Excess glutamine reduced the sensitivity to DON (Table S1), and excess levels of both glutamine and glutamate had deleterious effects on cells growth but reduced the sensitivity to AOA (data not shown). Surprisingly, both DON and AOA primarily inhibited the development of the peripheral areas of the biofilm (Fig. 2E).
Following the notion that the biofilm periphery and center cells differ in their requirement for glutamine and glutamate43, we quantified glutamine and glutamate levels in different layers of the biofilm, using mass spectrometry. We found significantly higher levels of both metabolites in the periphery than in the center (Fig. 3A,B). After differentiation, the peripheral regions in the biofilm were shown to rely on the TCA cycle, while the central regions were shown to rely on lactate utilization typical to anoxic growth27,41,67,68. Thus we hypothesized that the lower levels of glutamine and glutamate we find at the center of the biofilm, may correlate with increased levels of lactate. Indeed there was no difference in the levels of glutamine and glutamate between the central layer in aerobic conditions and a biofilm colony grown under anaerobic conditions (Fig. 3A,B). Importantly, under anaerobic conditions, morphogenesis is inhibited27 (Fig. S3). Consistent with the hypothesis that differential metabolism is mediated by morphogenesis, the concentrations of both lactate and glutamine were comparable in the center and edges during anaerobic conditions (an edge/center ratio of 0.6 folds for lactate, 1.4 folds for glutamate).
Under aerobic conditions, both lactate and glutamate, can serve as a carbon source, but only glutamate can also serve as a nitrogen source69,70. To directly evaluate whether the main dependence of the central biofilm is for carbon or nitrogen, we first assessed the correlation between the expression of glutamine synthase (glnR) and that of lactate dehydrogenase (ldh). For this, we deduced glnA expression levels from the expression levels of two independent reporter genes [β-galactosidase and GFP] driven by the operon promoter (located upstream to the adjacent gene glnR57), as was done previously for other genes44,55. We found that glnR expression is higher in the periphery of the colony, while ldh expression was higher in the center (Fig. 3C,D). Furthermore, supplementing glutamate to the medium enabled full biofilm development, while supplementation of lactate alone led to the formation of colonies that lacked complex morphologies (Fig. S4). Importantly, when grown in anoxic and anaerobic conditions, in which glycolysis becomes prominent, glnR expression decreased, while ldh expression increased (Fig. 3D).
These results support the previously described phenotype for the biofilm center of mutants for lactate metabolism67 and suggest that while both glutamate and lactate support biofilm growth, only glutamate, enables the formation of a wrinkled colonies. Thus, nitrogen is likely more essential than carbon for the development of the complex 3D morphology of the biofilm colonies. The spatial differences in activation of different metabolic reactions as reflected by differential gene expression between the periphery and central cells of the biofilm, might suggest that lactic acid fermentation by the inner cell mass of bacterial biofilms specifically in anaerobic conditions, plays a compensatory metabolic role to their utilization of carbon from glutamine.
To examine the metabolic dependence on glutamine of cells located in different regions of a biofilm colony, we compared the growth of cells harvested from the hypoxic center of the biofilm to the growth of cells harvested from the peripheral oxidized dividing edges. We found that bacterial growth in a nitrogen and carbon rich medium was not significantly different between the center and edges populations (Fig. 4A), while when grown on lactate as a sole carbon source, a weak but an apparent growth was observed only in cells taken from the center of the colony (Fig. 4B). On the other hand, when glutamate is provided as the sole carbon and nitrogen source, the growth rate of cells from the edges was significantly higher than the growth of cells from the center (Fig. 4C), supporting differential growth requirement for nitrogen and carbon sources between peripheral and central cells of the biofilm. Consistently, adding DON dramatically restricted the growth of the peripheral cells in a fresh medium while it had no significant effect on the central cells (Fig. 4D). This metabolic memory was lost upon regrowth in a rich medium for 4 hours (Fig. 4E). To further demonstrate that cells residing within the biofilm community can cooperate with each other by sharing nutrients, we grew a mixture of an equal amount of cells harvested from the center and the periphery in a medium containing both glutamate and lactate. As shown in Fig. 4F, a mixture of both cell types grew significantly better than each cell type alone. Interestingly, restricting glutamine levels with DON abolished the growth advantage for the mixture of cells even in the presence of glutamate as a nitrogen source and lactate as a carbon source (Fig. 4G), suggesting that glutamine supplementation provides a more available substrate for growth than glutamine, which has to be synthesized by the biofilm.
Finally, we show that this role of glutamine in biofilm development is not restricted only to B. subtilis. Two other species of pathogenic bacteria - Gram-positive E. faecalis and Gram-negative P. aeruginosa also depend on glutamine for biofilm formation (Fig. 5A,B) in a glutamine and glutamate dependent manner (Fig. 5C and Table S2), Overall, our results demonstrate that glutamine is an important cue for biofilm development in multiple bacterial species, and hence targeting its’ metabolism might lead to development of novel anti-biofilm therapies.
Discussion
Bacterial cells assemble into multicellular communities designated biofilms. These multicellular communities may be the primary life-style in which bacteria exist in nature8. In the past few decades, biofilms have been extensively characterized owing to their prominent role in disease, due to their increased antibiotic resistance as compared with planktonic cells14.
Multiple studies demonstrated that the environmental and physiological conditions are not homogeneous throughout a biofilm41,42,43, and that the metabolic activities of the cells, together with diffusion, result in nutrient concentration gradients and in differential gene expression43. Therefore, cells that are growing in biofilms are not only physiologically distinct from planktonic cells, but also become diverse, both spatially and temporally, as biofilm development proceeds. A key issue in restricting biofilm development is identifying the different metabolites whose distribution and synthesis play a cardinal role in biofilm development and differentiation.
We demonstrate here that glutamine and glutamate are essential for the development of biofilms, and that glutamine has a more significant role then glutamate. In continuation to the findings recently described43, we show here both a functional requirement and tight expression regulation for glutamine synthesis by the peripheral cells, which are important for biofilm growth, structure and survival (Fig. 5C). Furthermore, our results indicate that biofilm cells preserve a short-term memory of their metabolic activities, effecting their subsequent planktonic growth. This short-term memory of specific metabolic expertise is lost during re-culturing in rich medium, and may be a result of differential accumulation of stable metabolic proteins in the differentiated biofilm cells.
Importantly, from translational perspective, drugs inhibiting glutamine and glutamate synthesis results in disruption of the biofilm structure and biomass, as well as in interference with the metabolic cooperation between the cells residing in different biofilm layers. These results imply that disturbing glutamine and glutamate metabolism could potentially serve to inhibit biofilm formation, an immense need in different ecological, medical and biotechnological settings71,72,73.
References
Steinberg, N. & Kolodkin-Gal, I. The Matrix Reloaded: Probing the Extracellular Matrix Synchronizes Bacterial Communities. Journal of bacteriology, https://doi.org/10.1128/JB.02516-14 (2015).
Branda, S. S., Vik, S., Friedman, L. & Kolter, R. Biofilms: the matrix revisited. Trends in microbiology 13, 20–26, https://doi.org/10.1016/j.tim.2004.11.006 (2005).
Dragos, A. & Kovacs, A. T. The Peculiar Functions of the Bacterial Extracellular Matrix. Trends in microbiology 25, 257–266, https://doi.org/10.1016/j.tim.2016.12.010 (2017).
Li, X. et al. Spatial patterns of carbonate biomineralization in biofilms. Applied and environmental microbiology 81, 7403–7410, https://doi.org/10.1128/AEM.01585-15 (2015).
Li, X. et al. In Situ Biomineralization and Particle Deposition Distinctively Mediate Biofilm Susceptibility to Chlorine. Applied and environmental microbiology 82, 2886–2892, https://doi.org/10.1128/AEM.03954-15 (2016).
Oppenheimer-Shaanan, Y. et al. Spatio-temporal assembly of functional mineral scaffolds within microbial biofilms. NPJ Biofilms Microbiomes 2, 15031, https://doi.org/10.1038/npjbiofilms.2015.31 (2016).
Aguilar, C., Vlamakis, H., Losick, R. & Kolter, R. Thinking about Bacillus subtilis as a multicellular organism. Current opinion in microbiology 10, 638–643, https://doi.org/10.1016/j.mib.2007.09.006 (2007).
Kolter, R. & Greenberg, E. P. Microbial sciences: the superficial life of microbes. Nature 441, 300–302, https://doi.org/10.1038/441300a (2006).
Zeriouh, H., de Vicente, A., Perez-Garcia, A. & Romero, D. Surfactin triggers biofilm formation of Bacillus subtilis in melon phylloplane and contributes to the biocontrol activity. Environmental microbiology 16, 2196–2211, https://doi.org/10.1111/1462-2920.12271 (2014).
Gao, G. et al. Effect of biocontrol agent Pseudomonas fluorescens 2P24 on soil fungal community in cucumber rhizosphere using T-RFLP and DGGE. PloS one 7, e31806, https://doi.org/10.1371/journal.pone.0031806 (2012).
Beauregard, P. B., Chai, Y., Vlamakis, H., Losick, R. & Kolter, R. Bacillus subtilis biofilm induction by plant polysaccharides. Proceedings of the National Academy of Sciences of the United States of America 110, E1621–1630, https://doi.org/10.1073/pnas.1218984110 (2013).
Rudrappa, T., Czymmek, K. J., Pare, P. W. & Bais, H. P. Root-secreted malic acid recruits beneficial soil bacteria. Plant physiology 148, 1547–1556, https://doi.org/10.1104/pp.108.127613 (2008).
Costerton, J. W., Stewart, P. S. & Greenberg, E. P. Bacterial biofilms: a common cause of persistent infections. Science 284, 1318–1322 (1999).
Bryers, J. D. Medical biofilms. Biotechnology and bioengineering 100, 1–18, https://doi.org/10.1002/bit.21838 (2008).
Logan, B. E. Exoelectrogenic bacteria that power microbial fuel cells. Nature reviews. Microbiology 7, 375–381, https://doi.org/10.1038/nrmicro2113 (2009).
Nevin, K. P., Woodard, T. L., Franks, A. E., Summers, Z. M. & Lovley, D. R. Microbial electrosynthesis: feeding microbes electricity to convert carbon dioxide and water to multicarbon extracellular organic compounds. mBio 1, https://doi.org/10.1128/mBio.00103-10 (2010).
Torres, C. I. et al. A kinetic perspective on extracellular electron transfer by anode-respiring bacteria. FEMS microbiology reviews 34, 3–17, https://doi.org/10.1111/j.1574-6976.2009.00191.x (2010).
Chen, Y. et al. Biocontrol of tomato wilt disease by Bacillus subtilis isolates from natural environments depends on conserved genes mediating biofilm formation. Environmental microbiology 15, 848–864, https://doi.org/10.1111/j.1462-2920.2012.02860.x (2013).
Sanchez, C. Microbial ecology: Bacteria reinforce plant defences. Nature reviews. Microbiology 9, 483, https://doi.org/10.1038/nrmicro2598 (2011).
Lidbury, I., Johnson, V., Hall-Spencer, J. M., Munn, C. B. & Cunliffe, M. Community-level response of coastal microbial biofilms to ocean acidification in a natural carbon dioxide vent ecosystem. Marine pollution bulletin 64, 1063–1066, https://doi.org/10.1016/j.marpolbul.2012.02.011 (2012).
Cha, M., Hong, S., Kang, M. Y., Lee, J. W. & Jang, J. Gas-phase removal of biofilms from various surfaces using carbon dioxide aerosols. Biofouling 28, 681–686, https://doi.org/10.1080/08927014.2012.701624 (2012).
Branda, S. S., Gonzalez-Pastor, J. E., Ben-Yehuda, S., Losick, R. & Kolter, R. Fruiting body formation by Bacillus subtilis. Proc Natl Acad Sci USA 98, 11621–11626, https://doi.org/10.1073/pnas.191384198 (2001).
Branda, S. S. et al. Genes involved in formation of structured multicellular communities by Bacillus subtilis. Journal of bacteriology 186, 3970–3979, https://doi.org/10.1128/JB.186.12.3970-3979.2004 (2004).
Correction for Hobley et al., BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm. Proceedings of the National Academy of Sciences of the United States of America 112, E5371–5375, https://doi.org/10.1073/pnas.1516042112 (2015).
McLoon, A. L., Kolodkin-Gal, I., Rubinstein, S. M., Kolter, R. & Losick, R. Spatial regulation of histidine kinases governing biofilm formation in Bacillus subtilis. Journal of bacteriology 193, 679–685, https://doi.org/10.1128/JB.01186-10 (2011).
Bloom-Ackermann, Z. et al. Toxin-Antitoxin systems eliminate defective cells and preserve symmetry in Bacillus subtilis biofilms. Environmental microbiology 18, 5032–5047, https://doi.org/10.1111/1462-2920.13471 (2016).
Kolodkin-Gal, I. et al. Respiration control of multicellularity in Bacillus subtilis by a complex of the cytochrome chain with a membrane-embedded histidine kinase. Genes & development 27, 887–899, https://doi.org/10.1101/gad.215244.113 (2013).
Dietrich, L. E. et al. Bacterial community morphogenesis is intimately linked to the intracellular redox state. Journal of bacteriology 195, 1371–1380, https://doi.org/10.1128/JB.02273-12 (2013).
Kempes, C. P., Okegbe, C., Mears-Clarke, Z., Follows, M. J. & Dietrich, L. E. Morphological optimization for access to dual oxidants in biofilms. Proceedings of the National Academy of Sciences of the United States of America 111, 208–213, https://doi.org/10.1073/pnas.1315521110 (2014).
Lopez, D., Vlamakis, H., Losick, R. & Kolter, R. Paracrine signaling in a bacterium. Genes & development 23, 1631–1638, https://doi.org/10.1101/gad.1813709 (2009).
Romero, D., Traxler, M. F., Lopez, D. & Kolter, R. Antibiotics as signal molecules. Chemical reviews 111, 5492–5505, https://doi.org/10.1021/cr2000509 (2011).
Lopez, D., Vlamakis, H., Losick, R. & Kolter, R. Cannibalism enhances biofilm development in Bacillus subtilis. Molecular microbiology 74, 609–618, https://doi.org/10.1111/j.1365-2958.2009.06882.x (2009).
Mhatre, E. et al. Presence of Calcium Lowers the Expansion of Bacillus subtilis Colony Biofilms. Microorganisms 5, https://doi.org/10.3390/microorganisms5010007 (2017).
Rubinstein, S. M. et al. Osmotic pressure can regulate matrix gene expression in Bacillus subtilis. Molecular microbiology 86, 426–436, https://doi.org/10.1111/j.1365-2958.2012.08201.x (2012).
Cairns, L. S., Marlow, V. L., Bissett, E., Ostrowski, A. & Stanley-Wall, N. R. A mechanical signal transmitted by the flagellum controls signalling in Bacillus subtilis. Molecular microbiology 90, 6–21, https://doi.org/10.1111/mmi.12342 (2013).
Asally, M. et al. Localized cell death focuses mechanical forces during 3D patterning in a biofilm. Proceedings of the National Academy of Sciences of the United States of America 109, 18891–18896, https://doi.org/10.1073/pnas.1212429109 (2012).
Humphries, J. et al. Species-Independent Attraction to Biofilms through Electrical Signaling. Cell 168, 200–209 e212, https://doi.org/10.1016/j.cell.2016.12.014 (2017).
Monds, R. D. & O’Toole, G. A. The developmental model of microbial biofilms: ten years of a paradigm up for review. Trends in microbiology 17, 73–87, https://doi.org/10.1016/j.tim.2008.11.001 (2009).
Grau, R. R. et al. A Duo of Potassium-Responsive Histidine Kinases Govern the Multicellular Destiny of Bacillus subtilis. mBio 6, e00581, https://doi.org/10.1128/mBio.00581-15 (2015).
Mhatre, E., Monterrosa, R. G. & Kovacs, A. T. From environmental signals to regulators: modulation of biofilm development in Gram-positive bacteria. Journal of basic microbiology 54, 616–632, https://doi.org/10.1002/jobm.201400175 (2014).
Stewart, P. S. & Franklin, M. J. Physiological heterogeneity in biofilms. Nature reviews. Microbiology 6, 199–210, https://doi.org/10.1038/nrmicro1838 (2008).
Rani, S. A. et al. Spatial patterns of DNA replication, protein synthesis, and oxygen concentration within bacterial biofilms reveal diverse physiological states. Journal of bacteriology 189, 4223–4233, https://doi.org/10.1128/JB.00107-07 (2007).
Liu, J. et al. Metabolic co-dependence gives rise to collective oscillations within biofilms. Nature 523, 550–554, https://doi.org/10.1038/nature14660 (2015).
Noda-Garcia, L., Romero Romero, M. L., Longo, L. M., Kolodkin-Gal, I. & Tawfik, D. S. Bacilli glutamate dehydrogenases diverged via coevolution of transcription and enzyme regulation. EMBO reports, https://doi.org/10.15252/embr.201743990 (2017).
Sat, B. et al. Programmed cell death in Escherichia coli: some antibiotics can trigger mazEF lethality. Journal of bacteriology 183, 2041–2045, https://doi.org/10.1128/JB.183.6.2041-2045.2001 (2001).
Banin, E., Vasil, M. L. & Greenberg, E. P. Iron and Pseudomonas aeruginosa biofilm formation. Proceedings of the National Academy of Sciences of the United States of America 102, 11076–11081, https://doi.org/10.1073/pnas.0504266102 (2005).
Wilson, G. A. & Bott, K. F. Nutritional factors influencing the development of competence in the Bacillus subtilis transformation system. J Bacteriol 95, 1439–1449 (1968).
Chai, Y., Chu, F., Kolter, R. & Losick, R. Bistability and biofilm formation in Bacillus subtilis. Molecular microbiology 67, 254–263, https://doi.org/10.1111/j.1365-2958.2007.06040.x (2008).
Chastanet, A. & Losick, R. Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms. Journal of bacteriology 193, 6366–6374, https://doi.org/10.1128/JB.06057-11 (2011).
Chapel, T. A., Smeltzer, M. & Dassel, R. The effect of delaying incubation in a C02-enriched environment on gonococci. Health laboratory science 13, 45–48 (1976).
Nakano, M. M. & Zuber, P. Anaerobic growth of a “strict aerobe” (Bacillus subtilis). Annual review of microbiology 52, 165–190, https://doi.org/10.1146/annurev.micro.52.1.165 (1998).
Friedman, L. & Kolter, R. Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Molecular microbiology 51, 675–690 (2004).
Garcia-Betancur, J. C., Yepes, A., Schneider, J. & Lopez, D. Single-cell analysis of Bacillus subtilis biofilms using fluorescence microscopy and flow cytometry. Journal of visualized experiments: JoVE, https://doi.org/10.3791/3796 (2012).
Aguilar, C., Vlamakis, H., Guzman, A., Losick, R. & Kolter, R. KinD is a checkpoint protein linking spore formation to extracellular-matrix production in Bacillus subtilis biofilms. mBio 1, https://doi.org/10.1128/mBio.00035-10 (2010).
Vlamakis, H., Aguilar, C., Losick, R. & Kolter, R. Control of cell fate by the formation of an architecturally complex bacterial community. Genes & development 22, 945–953, https://doi.org/10.1101/gad.1645008 (2008).
DeBerardinis, R. J. & Cheng, T. Q’s next: the diverse functions of glutamine in metabolism, cell biology and cancer. Oncogene 29, 313–324, https://doi.org/10.1038/onc.2009.358 (2010).
Fisher, S. H. & Wray, L. V. Jr. Mutations in the Bacillus subtilis glnRA operon that cause nitrogen source-dependent defects in regulation of TnrA activity. Journal of bacteriology 184, 4636–4639 (2002).
Hauf, K., Kayumov, A., Gloge, F. & Forchhammer, K. The Molecular Basis of TnrA Control by Glutamine Synthetase in Bacillus subtilis. The Journal of biological chemistry 291, 3483–3495, https://doi.org/10.1074/jbc.M115.680991 (2016).
Mirouze, N., Bidnenko, E., Noirot, P. & Auger, S. Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. Microbiology Open 4, 423–435, https://doi.org/10.1002/mbo3.249 (2015).
Singh, R., Miriyala, S. S., Giri, L., Mitra, K. & Kareenhalli, V. V. Identification of unstructured model for subtilin production through Bacillus subtilis using hybrid genetic algorithm. Process Biochem 60, 1–12, https://doi.org/10.1016/j.procbio.2017.06.005 (2017).
Brown, G. et al. Functional and structural characterization of four glutaminases from Escherichia coli and Bacillus subtilis. Biochemistry 47, 5724–5735, https://doi.org/10.1021/bi800097h (2008).
Botsford, J. L. & Lewis, T. A. Osmoregulation in Rhizobium meliloti: Production of Glutamic Acid in Response to Osmotic Stress. Applied and environmental microbiology 56, 488–494 (1990).
Wybenga, G. G., Crismaru, C. G., Janssen, D. B. & Dijkstra, B. W. Structural determinants of the beta-selectivity of a bacterial aminotransferase. The Journal of biological chemistry 287, 28495–28502, https://doi.org/10.1074/jbc.M112.375238 (2012).
Erez, A. & Kolodkin-Gal, I. From Prokaryotes to Cancer: Glutamine Flux in Multicellular Units. Trends in endocrinology and metabolism: TEM, https://doi.org/10.1016/j.tem.2017.05.007 (2017).
Martin, M. et al. De novo evolved interference competition promotes the spread of biofilm defectors. Nature communications 8, 15127, https://doi.org/10.1038/ncomms15127 (2017).
Bucher, T., Oppenheimer-Shaanan, Y., Savidor, A., Bloom-Ackermann, Z. & Kolodkin-Gal, I. Disturbance of the bacterial cell wall specifically interferes with biofilm formation. Environmental microbiology reports, https://doi.org/10.1111/1758-2229.12346 (2015).
Chai, Y., Kolter, R. & Losick, R. A widely conserved gene cluster required for lactate utilization in Bacillus subtilis and its involvement in biofilm formation. Journal of bacteriology 191, 2423–2430, https://doi.org/10.1128/JB.01464-08 (2009).
Marino, M., Hoffmann, T., Schmid, R., Mobitz, H. & Jahn, D. Changes in protein synthesis during the adaptation of Bacillus subtilis to anaerobic growth conditions. Microbiology 146(Pt 1), 97–105, https://doi.org/10.1099/00221287-146-1-97 (2000).
Fisher, S. H. Regulation of nitrogen metabolism in Bacillus subtilis: vive la difference! Molecular microbiology 32, 223–232 (1999).
Fisher, S. H. & Sonenshein, A. L. Control of carbon and nitrogen metabolism in Bacillus subtilis. Annual review of microbiology 45, 107–135, https://doi.org/10.1146/annurev.mi.45.100191.000543 (1991).
Oppenheimer-Shaanan, Y., Steinberg, N. & Kolodkin-Gal, I. Small molecules are natural triggers for the disassembly of biofilms. Trends in microbiology, https://doi.org/10.1016/j.tim.2013.08.005 (2013).
Harmsen, M., Yang, L., Pamp, S. J. & Tolker-Nielsen, T. An update on Pseudomonas aeruginosa biofilm formation, tolerance, and dispersal. FEMS immunology and medical microbiology 59, 253–268, https://doi.org/10.1111/j.1574-695X.2010.00690.x (2010).
Tao, F. et al. Genome sequence of Rhodococcus erythropolis XP, a biodesulfurizing bacterium with industrial potential. Journal of bacteriology 193, 6422–6423, https://doi.org/10.1128/JB.06154-11 (2011).
Acknowledgements
We thank the Weizmann Institute for providing financial and infrastructural support. Specifically, we thank Dr. Alon Silberman for performing and analyzing the GCMS experiments. AE is incumbent of the Leah Omenn Career Development Chair and is supported by research grants from the European research program (CIG618113, ERC614204), the Israel Science Foundation (1343/13; 1952/13) and from the Minerva grant award (711730). AE received additional support from the Adelis Foundation, the Henry S. and Anne S. Reich Research Fund, the Dukler Fund for Cancer Research, the Paul Sparr Foundation, the Saul and Theresa Esman Foundation, from Joseph Piko Baruch, and from the estate of Fannie Sherr. IKG is supported by the ISF I-CORE grant 152/1, Mr. and Mrs. Dan Kane, Ms. Lois Rosen, by the Larson Charitable Foundation, by Ruth and Herman Albert Scholars Program for New Scientists, by the University of Michigan-Technion-Weizmann Research grant, and by the France-Israel Cooperation - Maimonide-Israel Research Program grant 3-13021, by the Kekst Family Institute for Medical Genetics and by the Israeli Science Foundation (No. 119/16). IKG is a recipient of the Rowland and Sylvia Career Development Chair.
Author information
Authors and Affiliations
Contributions
I.K.G. designed the biofilm experiments, A.E. designed the GC-MS experiments, A.E., I.K., T.H. and N.S. contributed strains and reagents. I.K.G. and A.E. wrote the manuscript. I.K.G. performed the biofilm experiments.
Corresponding author
Ethics declarations
Competing Interests
The authors declare no competing interests.
Additional information
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Hassanov, T., Karunker, I., Steinberg, N. et al. Novel antibiofilm chemotherapies target nitrogen from glutamate and glutamine. Sci Rep 8, 7097 (2018). https://doi.org/10.1038/s41598-018-25401-z
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-018-25401-z
This article is cited by
-
The metabolomic plasma profile of patients with Duchenne muscular dystrophy: providing new evidence for its pathogenesis
Orphanet Journal of Rare Diseases (2023)
-
Drug delivery strategies for antibiofilm therapy
Nature Reviews Microbiology (2023)
-
A counter-enzyme complex regulates glutamate metabolism in Bacillus subtilis
Nature Chemical Biology (2022)
-
GltS regulates biofilm formation in methicillin-resistant Staphylococcus aureus
Communications Biology (2022)
-
Biofilm formation displays intrinsic offensive and defensive features of Bacillus cereus
npj Biofilms and Microbiomes (2020)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.