Figures
Abstract
Accumulating evidence suggests that RNAs interacting with genomic regions play important roles in the regulation of genome functions, including X chromosome inactivation and gene expression. However, to our knowledge, no non-biased methods of identifying RNAs that interact with a specific genomic region have been reported. Here, we used enChIP-RNA-Seq, a combination of engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) and RNA sequencing (RNA-Seq), to perform a non-biased search for RNAs interacting with telomeres. In enChIP-RNA-Seq, the target genomic regions are captured using an engineered DNA-binding molecule such as a transcription activator-like protein. Subsequently, RNAs that interact with the target genomic regions are purified and sequenced. The RNAs detected by enChIP-RNA-Seq contained known telomere-binding RNAs, including the telomerase RNA component (Terc), the RNA component of mitochondrial RNA processing endoribonuclease (Rmrp), and Cajal body-specific RNAs. In addition, a number of novel telomere-binding non-coding RNAs were also identified. Binding of two candidate non-coding RNAs to telomeres was confirmed by immunofluorescence microscopy and RNA fluorescence in situ hybridization (RNA-FISH) analyses. The novel telomere-binding non-coding RNAs identified here may play important roles in telomere functions. To our knowledge, this study is the first non-biased identification of RNAs associated with specific genomic regions. The results presented here suggest that enChIP-RNA-Seq analyses are useful for the identification of RNAs interacting with specific genomic regions, and may help to contribute to current understanding of the regulation of genome functions.
Citation: Fujita T, Yuno M, Okuzaki D, Ohki R, Fujii H (2015) Identification of Non-Coding RNAs Associated with Telomeres Using a Combination of enChIP and RNA Sequencing. PLoS ONE 10(4): e0123387. https://doi.org/10.1371/journal.pone.0123387
Academic Editor: Charalampos Babis Spilianakis, University of Crete, GREECE
Received: September 9, 2014; Accepted: February 18, 2015; Published: April 13, 2015
Copyright: © 2015 Fujita et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Data Availability: All RNA-Seq data are available from the NCBI Gene Expression Omnibus (GEO) database with accession number GSE60425.
Funding: This work was supported by Takeda Science Foundation (T. F.), the Asahi Glass Foundation, the Uehara Memorial Foundation (H. F.), the Kurata Memorial Hitachi Science and Technology Foundation (T. F. and H. F.), Grant-in-Aid for Young Scientists (B) (#25830131) (T. F.), Grant-in-Aid for Scientific Research (C) (#26430133) (R. O.), Grant-in-Aid for Scientific Research on Innovative Areas "Cell Fate" (#23118516) (T. F.), "Transcription Cycle" (#25118512), "Genome Support" (#221S0002) (H. F.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and Applied Research for Innovative Treatment of Cancer from the Ministry of Health, Labour and Welfare (R. O.). The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.
Competing interests: H. F. is an Academic Editor of PLOS ONE, and T. F. and H. F. have filed a patent application for enChIP (Name: “Method for isolating specific genomic regions using DNA-binding molecules recognizing endogenous DNA sequences"; Number: PCT/JP2013/74107). There are no further patents, products in development, or marketed products to declare. These interests do not alter the authors' adherence to the PLOS ONE editorial policies and criteria.
Introduction
Accumulating evidence suggests that RNAs interact with genomic regions to regulate their functions [1]. The regulation of genome functions by interacting RNAs occurs during X chromosome inactivation [2, 3], genomic imprinting [3], transcriptional regulation [4], and other processes. The interaction of a specific RNA with genomic regions can be detected by several techniques, such as fluorescent in situ hybridization (FISH) [5] and oligonucleotide-mediated affinity purification [6–9]. These methods can be used if information on the candidate RNAs is available; however, they are not suitable for non-biased searches for RNAs that interact with specific genomic regions.
Recently, we developed two locus-specific chromatin immunoprecipitation (locus-specific ChIP) technologies, namely insertional ChIP (iChIP) [10–15] and engineered DNA-binding molecule-mediated ChIP (enChIP) [16–18]. These locus-specific ChIP technologies enable the purification of specific genomic regions while retaining molecular interactions, and the combination of iChIP or enChIP with mass spectrometry can identify proteins that interact with specific genomic regions [11, 15–18]. We also showed that the combination of iChIP or enChIP with RT-PCR can detect RNA species that interact with the chicken β-globin HS4 element [11], telomeres [17], and the chicken Pax5 locus [14].
Telomeres are specialized chromatin structures that protect the ends of chromosomes from being recognized as broken DNA [19]. Telomeres consist of a 5–15 kb tandem repetitive array of T2AG3 sequences (telomeric repeats) and interacting RNAs and proteins, which form a large DNA-RNA-protein complex. Telomeric repeats are maintained by the action of telomerase, which comprises a protein component named telomerase reverse transcriptase (TERT), and an RNA component named Terc [20, 21]. In addition to Terc, other RNAs also interact with the telomerase complex via a direct interaction with TERT or an indirect interaction with other telomerase-associated proteins [22, 23]. Although extensive analyses have been performed to identify RNAs associated with telomeres, current knowledge of telomere-associated non-coding RNAs is far from complete.
Here, We Combined Enchip With Rna Sequencing (Rna-Seq), Hereafter Referred To As Enchip-Rna-Seq, To Perform A Non-Biased Investigation Of Non-Coding Rnas That Interact With Telomeres. Using This Method, Both Known And Novel Telomere-Interacting Rnas Were Identified. We Propose That Enchip-Rna-Seq Is A Useful Tool For Analyzing The Effects Of Specific Rnas On Genome Functions.
Results and Discussion
Identification of RNA species associated with telomeres by enChIP-RNA-Seq
We recently reported the isolation of telomeres by enChIP using a transcription activator-like (TAL) protein that recognizes telomeres (Tel-TAL) [17]. In this previous study, Tel-TAL fused with a 3xFLAG-tag and nuclear localization signal (NLS), hereafter referred as 3xFN-Tel-TAL, was expressed in the Ba/F3 mouse hematopoietic cell line [24], which expresses functional telomerase [25]. The cells were treated with formaldehyde and the crosslinked chromatin was fragmented by sonication. Next, chromatin complexes bound to 3xFN-Tel-TAL were immunoprecipitated with an anti-FLAG antibody (Ab), and telomere-binding proteins and Terc were identified by mass spectrometry and RT-PCR analyses, respectively [17].
Here, we used enChIP-RNA-Seq to identify telomere-associated RNAs in a non-biased manner (Fig 1). The RNAs were isolated from Ba/F3 cells expressing 3xFN-Tel-TAL [17] or 3xFLAG-tag-fused LexA (3xFNLDD) as a negative control [17]. We showed previously that 3xFN-Tel-TAL binds specifically to telomeres and enrichment of irrelevant genomic regions is marginal when enChIP is performed using this protein [17]. RNAs that were more abundant in isolates from enChIP from Ba/F3 expressing 3xFN-Tel-TAL than those from Ba/F3 expressing 3xFNLDD were considered as potential telomere-binding RNAs. The non-coding RNAs that potentially interact with telomeres are shown in Table 1 and S1 Table (S2 Table shows the full list of RNAs including both coding and non-coding RNAs that potentially interact with telomeres). The list contains known telomere-binding RNAs, such as Terc [20, 21], the RNA component of mitochondrial RNA processing endoribonuclease (Rmrp) [23], and small Cajal body-specific RNAs (scaRNAs) [22]. In addition, based on the number of reads containing (TTAGGG)4 or (CCCTAA)4 motifs [26], we detected a specific enrichment of telomeric repeat-containing RNAs (TERRAs) [27, 28] in the RNA-Seq data from the 3xFN-Tel-TAL samples (Fig 2).
(A, B) The enChIP-RNA-Seq system comprises a fusion molecule consisting of a tag(s), a nuclear localization signal (NLS), and an engineered DNA-binding molecule such as a transcription activator-like (TAL) protein, which recognizes endogenous target DNA sequences. The 3xFN-TAL protein comprising a 3xFLAG-tag, an NLS, and a TAL protein recognizing the target sequence is an example of the fusion molecule. (C) The 3xFN-TAL protein is expressed in a cell. If necessary, the sample is crosslinked with formaldehyde or another crosslinker, and then the chromatin is fragmented by sonication, enzymatic digestion, or another method. The chromatin complexes are purified by immunoprecipitation with an anti-FLAG Ab. Subsequently, the crosslinking is reversed (if required) and RNAs are purified and subjected to RNA-Seq.
(A) The numbers of TERRA transcripts in the negative control (3xFNLDD) and 3xFN-Tel-TAL enChIP-RNA-Seq samples. (B) Mapping of TERRA transcripts at a telomeric region in chromosome 18.
As mentioned above, the telomerase holoenzyme consists of TERT, a protein with reverse transcriptase activity, and Terc, which serves as a template for the telomere repeats [20] and is a member of the H/ACA family of RNAs [29, 30]. A previous RT-PCR analysis detected Terc in telomeres purified by enChIP [17]. Rmrp is a non-coding RNA that is found in the nucleolus and mitochondria [31], and is mutated in the inherited pleiotropic syndrome cartilage-hair hypoplasia [32]. TERT and Rmrp form a ribonucleoprotein complex that retains RNA-dependent RNA polymerase activity [23]. The scaRNAs, which are also members of the H/ACA RNA family [29, 30], are localized in Cajal bodies and are involved in modifying splicing RNAs. Furthermore, scaRNAs interact with telomere Cajal body protein 1 (TCAB1) at telomeres [22]. TERRAs are UUAGGG repeat-containing RNAs that are transcribed from subtelomeric regions [27] and may play important roles in telomere functions [26–28].
Several members of the H/ACA family of small nucleolar RNAs (snoRNAs) were more abundant in isolates from enChIP from Ba/F3 expressing 3xFN-Tel-TAL than those from Ba/F3 expressing 3xFNLDD (Table 1 and S1 Table). The functional telomerase complex contains dyskerin, an RNA-binding protein that recognizes the H/ACA sequence motif [33, 34]; therefore, it is likely that these H/ACA snoRNAs are recruited to telomeres through interactions with dyskerin [33, 34].
The fact that we detected known telomere-binding RNAs using enChIP-RNA-Seq suggests that it is feasible to use this technology to perform non-biased identification of RNAs interacting with genomic regions of interest in vivo. In addition to known telomere-binding RNAs, a number of novel potential telomere-binding RNAs were also identified using enChIP-RNA-Seq, including long non-coding RNAs (lncRNAs) and members of the snoRNA family containing C and D motifs (C/D snoRNAs) (Table 1 and S1 Table). To identify a new functional class of lncRNAs that are enriched in telomeres, we re-analyzed the assembly and quantification of the RNA-Seq data (Table 2 and S3 Table). Overall, the non-coding RNAs identified using enChIP-RNA-Seq might play important roles in telomere biology.
Confirmation of localization of the candidate RNAs at telomeres by RNA-FISH
To verify association of the candidate RNAs identified using enChIP-RNA-Seq with telomeres, RNA-FISH analyses were performed using the human osteosarcoma U-2 OS cell line. These experiments showed significant co-localization of two candidate RNAs, namely SNORD17 (snoRNA, C/D box 17) and NEAT1 (nuclear-enriched abundant transcript 1), with TRF2, a marker protein of telomeres (Fig 3). These results confirmed the localization of the two candidate RNAs with telomeres. It is of note that not all the RNAs' foci are located at telomeres, suggesting that these RNAs may function not only in telomeres but also in other regions in the nucleus.
Localization of SNORD17 (A) and NEAT1 (B) at telomeres in human U-2 OS cells. Cells were fixed and sequentially incubated with Abs against TRF-2 and AlexaFluor 488-conjugated anti-mouse IgG. Subsequently, the cells were hybridized with the RNA probes and subjected to fluorescence microscopy. Three different cells are shown.
Snord17 belongs to the C/D snoRNA family [30]. Specific enrichment of other members of the C/D snoRNA family, including Snord15a and Snord118, were also present in telomeres isolated by enChIP (Table 1 and S1 Table). The C/D snoRNAs play important roles in major biological processes, such as translation, mRNA splicing, and genome stability [30]. Although involvement of the H/ACA snoRNAs in telomere biology is well documented [33, 34], to our knowledge, the results presented here are the first to suggest the potential involvement of the C/D snoRNAs in telomere biology. Neat1 is a lncRNA that is localized to and is essential for the formation of paraspeckles [35]. The enChIP-RNA-Seq data suggest that Neat1 is also associated with telomeres and may be involved in telomere biology. Consistent with this idea, it has been reported that the localization of Neat1 is similar to that of TERRAs transcribed from telomeres [36]. It will be interesting to determine how these newly-identified RNAs are involved in telomere functions.
Non-biased identification of RNAs associated with specific genomic regions by enChIP-RNA-Seq
Here, we used enChIP-RNA-Seq to perform a non-biased search for RNAs interacting with telomeres. This approach can easily be applied to low copy number loci; in fact, we have identified RNAs associated with a single copy gene using RNA-Seq combined with iChIP or enChIP using the CRISPR system (T.F. and H.F., manuscript in preparation). This approach would be a method of choice for identifying RNAs that are associated with a specific genomic locus in vivo.
Conclusions
This Study Describes The Use Of Enchip-Rna-Seq To Detect Known Telomere-Binding Non-Coding Rnas, Including Terc, Rmrp, Terras, And Scarnas (Table 1 And Fig 2), As Well As A Number Of Novel Potential Telomere-Binding Non-Coding Rnas (Tables 1 And 2). The Localization Of Two Of The Candidate Rnas At Telomeres Was Confirmed By Immunofluorescence Microscopy And Rna-Fish Analyses (Fig 3). The Novel Potential Telomere-Binding Rnas Identified Here May Play Important Roles In Telomere Functions. Our Results Also Suggest That Enchip-Rna-Seq Analyses May Be Useful For The Identification Of Rnas Interacting With Specific Genomic Regions In Vivo.
Materials and Methods
Cells
The Ba/F3 mouse hematopoietic cell line [24] was obtained from the RIKEN BioResource Center (RCB0805). The generation of Ba/F3 cells stably expressing 3xFNLDD or 3xFN-Tel-TAL has been described previously [17]. The U-2 OS human osteosarcoma cell line [37] was obtained from ATCC (HTB-96). The Ba/F3-derived cells and U-2 OS cells were cultured as described previously [17].
enChIP-RNA-Seq analysis
Purification of RNAs following enChIP was performed as described previously [17], with some modifications. Briefly, 2 × 107 Ba/F3 cells expressing 3xFNLDD or 3xFN-Tel-TAL were fixed with 1% formaldehyde at 37°C for 5 min. The chromatin fraction was extracted and fragmented by sonication as described previously [11]. The sonicated chromatin was pre-cleared with normal mouse IgG (Santa Cruz Biotechnology) conjugated to Dynabeads-Protein G (Invitrogen), and then incubated with an anti-FLAG M2 Ab (Sigma-Aldrich) conjugated to Dynabeads-Protein G at 4°C. After washing, the total RNA was purified using Isogen II (Nippon Gene) and the Direct-zol RNA MiniPrep Kit (Zymo Research), and treated with DNase I. To obtain a list of RNAs that were differentially present between the two groups (S2 Table), the purified RNAs from cells expressing 3xFNLDD (194.1 ng) or 3xFN-Tel-TAL (160.5 ng) were subjected to RNA-Seq analyses (Takara Bio Inc.). The list of RNAs was sorted according to fold enrichment (read counts of cells expressing 3xFN-Tel-TAL / read counts of cells expressing 3xFNLDD). The non-coding RNAs that were identified as enriched at telomeres (>1.4-fold) are shown in S1 Table. The raw RNA-Seq data have been deposited in the NCBI Gene Expression Omnibus (GEO) database with accession number GSE60425. Details of the sequencing protocol are described on the GEO website.
Detection of TERRAs in the RNA-Seq data
To estimate the number of putative TERRAs, reads containing (TTAGGG)4 or (CCCTAA)4 repeats were extracted from each fastq file using the grep command in the UNIX system, as described previously [26].
Identification of lncRNAs in the RNA-Seq data
To identify a new functional class of lncRNAs enriched in telomeres, the assembly and quantification of the RNA-Seq data were re-analyzed using AvadisNGS software (ver. 1.5.1; Strand Sciences). A total of 3,540 lncRNAs were extracted using Agilent lncRNA probes (Design ID: 028005, Agilent Technologies). The lncRNA probes (16,251 probes, http://www.genomics.agilent.com/article.jsp?crumbAction=push&pageId=1520) were re-annotated according to the NONCODE v3.0 database (http://www.noncode.org/) (S3 Table). The RNA-Seq data were normalized according to the number of reads per million, and the lncRNAs were selected by filtering using cutoffs of more than 50 read counts for the 3xFN-Tel-TAL sample and less than 500 read counts for the control 3xFNLDD sample. A total of 611 lncRNAs passed the cutoffs and were extracted. Finally, ten candidate lncRNAs with log2 fold enrichment scores >1.36, corresponding to >2.5-fold increase in the 3xFN-Tel-TAL sample compared with the 3xFNLDD sample, were identified (Table 2).
Probes for RNA-FISH
The sequence of the human SNORD17 probe (synthesized by Life Technologies Inc.) was as follows: 5'-GTGAAATGATGATTCAGTTTATCCATTCGCTGAGTGCGCTGCACTGACCTTCTTCCAAGCCTCAGTTCCTGTTCTAGGAACTTGAGGCTATGTAGCCTGAAAATGCCCTGCAGTCTGCAGTGTTCTACTGTGAACTGCTTGTGTGTTGGCAGGCTACCGGTAAGAATGGTTGGTGTCAGCAGGGACGGGGCCCTCTGAGACCCATCTCACAAAGATGAGTGGTGAAAATCTGATCAC-3'. The human NEAT1 probe was generated by PCR amplification using 293T genomic DNA as template and the primers (hNEAT1_shortprobe_F and hNEAT1_shortprobe_R) described previously [38]. The RNA-FISH probes were generated by PCR using Cy3-labelled dCTP (Amersham).
Immunofluorescence combined with RNA-FISH
Immnofluorescence combined with RNA-FISH was performed as described previously [39]. Briefly, cells grown on coverslips were washed with phosphate-buffered saline (PBS), permeabilized with PBS supplemented with 0.5% Triton X-100 for 2 min, and then washed with PBS. Subsequently, cell were fixed for 10 min in 4% paraformaldehyde in PBS, and then permeabilized again with PBS containing 0.5% Triton X-100 for 2 min. After a further wash with PBS, the coverslips were incubated with blocking solution [PBS, 3% (w/v) bovine serum albumin, 0.1% Tween-20, 0.3 μg/μl tRNA (Life Technologies), and 100 units/ml RNasin (Takara Bio Inc)] for 60 min. The cells were then incubated with an anti-TRF2 Ab (Novus Biologicals; NB100-56506) in blocking solution for 60 min at 37°C, and washed twice with PBS containing 0.05% Tween-20. Subsequently, the cells were incubated with AlexaFluor 488-conjugated goat anti-mouse IgG (H+L) (Life Technologies) in blocking solution for 60 min at 37°C, and then washed three times with PBS containing 0.05% Tween-20. After re-fixation with PBS containing 4% paraformaldehyde, the cells were dehydrated sequentially with 70%, 80%, 95%, and 100% ethanol, air-dried, and then hybridized with the RNA probes in hybridization buffer (2xSSC and 50% formamide) at 37°C overnight. After the incubation, the cells were washed three times with hybridization buffer at 37°C, three times with 2xSSC at 37°C, once with 1xSSC at 37°C, once with 4xSSC at room temperature, once with 4xSSC containing 0.1% Tween-20 at room temperature, and once with 4xSSC at room temperature. The signals were visualized using the BZ-9000 fluorescent microscope (Keyence).
Supporting Information
S1 Table. Non-coding RNAs associated with telomeres, as identified by enChIP-RNA-Seq analyses.
https://doi.org/10.1371/journal.pone.0123387.s001
(XLSX)
S2 Table. RNAs detected by enChIP-RNA-Seq analyses.
https://doi.org/10.1371/journal.pone.0123387.s002
(XLSX)
S3 Table. The lncRNAs identified as enriched in telomeres.
https://doi.org/10.1371/journal.pone.0123387.s003
(XLSX)
Acknowledgments
We thank F. Kitaura for technical assistance. We also thank K. Torigata for bioinformatics analysis of the enChIP-RNA-Seq data.
Author Contributions
Conceived and designed the experiments: TF HF. Performed the experiments: TF MY DO RO HF. Analyzed the data: TF MY DO RO HF. Contributed reagents/materials/analysis tools: TF MY DO RO HF. Wrote the paper: TF HF. Directed and supervised the research: HF.
References
- 1. Yang L, Froberg JE, Lee JT. Long noncoding RNAs: fresh perspectives into the RNA world. Trends Biochem Sci. 2014;39:35–43. pmid:24290031
- 2. Gendrel AV, Heard E. Noncoding RNAs and Epigenetic Mechanisms During X-Chromosome Inactivation. Annu Rev Cell Dev Biol. 2014;in press.
- 3. Lee JT, Bartolomei MS. X-inactivation, imprinting, and long noncoding RNAs in health and disease. Cell. 2014;152:1308–23.
- 4. Vance KW, Ponting CP. Transcriptional regulatory functions of nuclear long noncoding RNAs. Trends Genet. 2014;30:348–55. pmid:24974018
- 5. Kwon S. Single-molecule fluorescence in situ hybridization: quantitative imaging of single RNA molecules. BMB Rep. 2013;46:65–72. pmid:23433107
- 6. Mainer PD, Walters RD, Espinoza CA, Drullinger LF, Wagner SD, Kugel JF, et al. Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock. Mol Cell. 2008;29:499–509. pmid:18313387
- 7. Chu C, Qu K, Zhong FL, Artandi SE, Chang HY. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions. Mol Cell. 2011;44:667–78. pmid:21963238
- 8. Simon MD, Wang CI, Kharchenko PV, West JA, Chapman BA, Alekseyenko AA, et al. The genomic binding sites of a noncoding RNA. Proc Natl Acad Sci U S A. 2011;108:20497–502. pmid:22143764
- 9. Engreitz J, Pandya-Jones A, McDonel P, Shishkin A, Sirokman K, Surka C, et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 2013;341:1237973. pmid:23828888
- 10. Hoshino A, Fujii H. Insertional chromatin immunoprecipitation: a method for isolating specific genomic regions. J Biosci Bioeng. 2009;108(5):446–9. pmid:19804873
- 11. Fujita T, Fujii H. Direct idenification of insulator components by insertional chromatin immunoprecipitation. PLoS One. 2011;6(10):e26109. pmid:22043306
- 12. Fujita T, Fujii H. Efficient isolation of specific genomic regions by insertional chromatin immunoprecipitation (iChIP) with a second-generation tagged LexA DNA-binding domain. Adv Biosci Biotechnol. 2012;3(5):626–9.
- 13. Fujita T, Fujii H. Locus-specific biochemical epigenetics / chromatin biochemistry by insertional chromatin immunoprecipitation. ISRN Biochem. 2013;2013:Article ID 913273.
- 14. Fujita T, Fujii H. Efficient isolation of specific genomic regions retaining molecular interactions by the iChIP system using recombinant exogenous DNA-binding proteins. BMC Mol Biol. 2014;15:26. pmid:25428274
- 15. Fujita T, Kitaura F, Fujii H. A critical role of the Thy28-MYH9 axis in B cell-specific expression of the Pax5 gene in chicken B cells. PLoS One. 2015;10:e0116579. pmid:25607658
- 16. Fujita T, Fujii H. Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013;439:132–6. pmid:23942116
- 17. Fujita T, Asano Y, Ohtsuka J, Takada Y, Saito K, Ohki R, et al. Identification of telomere-associated molecules by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Sci Rep. 2013;3:3171. pmid:24201379
- 18. Fujita T, Fujii H. Identification of proteins associated with an IFNγ-responsive promoter by a retroviral expression system for enChIP using CRISPR. PLoS One. 2014;9(7):e103084. pmid:25051498
- 19. Blackburn EH. Telomeres and telomerase: their mechanisms of action and the effects of altering their functions. FEBS Lett. 2005;579:859–62. pmid:15680963
- 20. Shippen-Lentz D, Blackburn EH. Functional evidence for an RNA template in telomerase. Science. 1990;247:546–52. pmid:1689074
- 21. Bryan TM, Englezou A, Dalla-Pozza L, Dunham MA, Reddel RR. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med. 1997;3:1271–4. pmid:9359704
- 22. Venteicher AS, Abreu EB, Meng Z, McCann KE, Terns RM, Veenstra TD, et al. A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science. 2009;323:644–8. pmid:19179534
- 23. Maida Y, Yasukawa M, Furuuchi M, Lassmann T, Possemato R, Okamoto N, et al. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature. 2009;461:230–5. pmid:19701182
- 24. Palacios R, Steinmetz M. IL3-dependent mouse clones that express B-220 surface-antigen, contain Ig genes in germ-line configuration, and generate lymphocytes-B in vivo. Cell. 1985;41:727–34. pmid:3924409
- 25. Uziel O, Fenig E, Nordenberg J, Beery E, Reshef H, Sandbank J, et al. Imatinib mesylate (Gleevec) downregulates telomerase activity and inhibits proliferation in telomerase-expressing cell lines. Br J Cancer. 2005;92:1881–91. pmid:15870711
- 26. de Silanes IL, Graña O, De Bonis ML, Dominguez O, Pisano DG, Blasco MA. Identification of TERRA locus unveils a telomere protection role through association to nearly all chromosomes. Nat Commun. 2014;5:4723. pmid:25182072
- 27. Azzalin CM, Reichenbach P, Khoriauli L, Giulotto E, Lingner J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 2007;318:798–801. pmid:17916692
- 28. Schoeftner S, Blasco MA. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol. 2008;10:228–36. pmid:18157120
- 29. Meier UT. The many facets of H/ACA ribonucleoproteins. Chromosoma. 2005;114:1–14. pmid:15770508
- 30. Matera AG, Terns RM, Terns MP. Non-coding RNAs: lessons from the small nuclear and small nucleolar RNAs. Nat Rev Mol Cell Biol. 2007;8:209–20. pmid:17318225
- 31. Tollervey D, Kiss T. Function and synthesis of small nucleolar RNAs. Curr Opin Cell Biol. 1997;9:337–42. pmid:9159079
- 32. Ridanpää M, van Eenennaam H, Pelin K, Chadwick R, Johnson C, Yuan B, et al. Mutations in the RNA component of RNase MRP cause a pleiotropic human disease, cartilage-hair hypoplasia. Cell. 2001;104:195–203. pmid:11207361
- 33. Mitchell JR, Wood E, Collins K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature. 1999;402:551–5. pmid:10591218
- 34. Mochizuki Y, He J, Kulkarni S, Bessler M, Mason PJ. Mouse dyskerin mutations affect accumulation of telomerase RNA and small nucleolar RNA, telomerase activity, and ribosomal RNA processing. Proc Natl Acad Sci U S A. 2004;101:10756–61. pmid:15240872
- 35. Naganuma T, Hirose T. Paraspeckle formation during the biogenesis of long non-coding RNAs. RNA Biol. 2013;10:456–61. pmid:23324609
- 36. Porro A, Feuerhahn S, Reichenbach P, Lingner J. Molecular dissection of telomeric repeat-containing RNA biogenesis unveils the presence of distinct and multiple regulatory pathways. Mol Cell Biol. 2010;30:4808–17. pmid:20713443
- 37. Pontén J, Saksela E. Two established in vitro cell lines from human mesenchymal tumours. Int J Cancer. 1967;2:434–47. pmid:6081590
- 38. Hutchinson JN, Ensminger AW, Clemson CM, Lynch CR, Lawrence JB, Chess A. A screen for nuclear transcripts identifies two linked noncoding RNAs associated with SC35 splicing domains. BMC Genomics. 2007;8:39. pmid:17270048
- 39. López de Silanes I, Stagno d'Alcontres M, Blasco MA. TERRA transcripts are bound by a complex array of RNA-binding proteins. Nat Commun. 2010;1:33. pmid:20975687