El Niño events are characterized by surface warming of the tropical Pacific Ocean and
weakening of equatorial trade winds that occur every few years. Such conditions are …

G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences
that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex …

Neurons in the spinal dorsal horn process sensory information, which is then transmitted to
several brain regions, including those responsible for pain perception. The dorsal horn …

Background Osimertinib is a third-generation, irreversible tyrosine kinase inhibitor of the
epidermal growth factor receptor (EGFR-TKI) that selectively inhibits both EGFR-TKI–sensitizing …

We report here the results of a systematic search for the existence and prevalence of potential
intramolecular G-quadruplex forming sequences in the human genome. We have also …

Our understanding of the fundamental structure and bonding of graphene oxide (GO) as well
as the scope of its utility have grown tremendously over the past decade. As a result, the …

Five experiments investigated the hypothesis that perspective taking—actively contemplating
others' psychological experiences—attenuates automatic expressions of racial bias. …

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region
of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and …

School-wide Positive Behavior Support Page 1 School-wide Positive Behavior Support Rob
Horner and George Sugai University of Oregon and University of Connecticut www.pbis.org …

The distributions of GABA‐like and glycine‐like immunoreactivities in the rat spinal cord
were compared by using postembedding immunohistochemistry on semithin sections. In …