Fig. 1 ROSA 26 targeting. a, Top, restriction map of the locus. PCR primers from ROSA26
flanking (5− CCTAAAGAAGAGGCTGTGCTTTGG− 3) and splice acceptor (5− …

A general strategy for selecting insertion mutations in mice has been devised. Constructs
lacking a promoter and including a beta-galactosidase gene, or a reporter gene encoding a …

Neural crest cells are multipotential stem cells that contribute extensively to vertebrate
development and give rise to various cell and tissue types. Determination of the fate of …

Platelet-derived growth factor, a major mitogen and chemoattractant for a number of cell types,
is implicated in the processes of wound healing, tumorigenesis, and differentiation and is …

Mice with mutations in four nonreceptor tyrosine kinase genes, fyn, src, yes, and abl, were
used to study the role of these kinases in long-term potentiation (LTP) and in the relation of …

A subpopulation of neural crest termed the cardiac neural crest is required in avian embryos
to initiate reorganization of the outflow tract of the developing cardiovascular system. In …

The ROSAβgeo26 (ROSA26) mouse strain was produced by random retroviral gene trapping
in embryonic stem cells. Staining of ROSA26 tissues and fluorescence-activated cell sorter-…

Src family kinases (SFKs) have been implicated as important regulators of ligand‐induced
cellular responses including proliferation, survival, adhesion and migration. Analysis of SFK …

Heterodimers between tissue-specific basic-helix-loop helix proteins and the gene products
of E2A play major roles in determining tissue-specific ceil fate. To understand the broad role …

Platelet-derived growth factors (PDGFs) have been implicated in the control of cell
proliferation, survival and migration. Patch mutant mice harbor a deletion including the PDGFα …