ABSTRACT
De novo DNA methylation (DNAme) during mammalian spermatogenesis yields a densely methylated genome, with the exception of CpG islands (CGIs), which are hypomethylated in sperm. Following fertilization, the paternal genome undergoes widespread DNAme loss before the first S-phase. Paradoxically, recent mass spectrometry analysis revealed that a low level of de novo DNAme occurs exclusively on the zygotic paternal genome. However, the loci involved and impact on genic transcription was not addressed. Here, we employ allele-specific analysis of wholegenome bisulphite sequencing (WGBS) data and show that a number of genomic regions, including several dozen CGI promoters, are de novo methylated on the paternal genome in 2-cell embryos. A subset of these promoters maintains DNAme through development to the blastocyst stage. Consistent with zygotic paternal DNAme acquisition (PDA), many of these loci are hypermethylated in androgenetic blastocysts but hypomethylated in parthenogenetic blastocysts. Strikingly, PDA is lost following maternal deletion of Dnmt3a. Furthermore, a subset of promoters showing PDA which are normally transcribed from the paternal allele in blastocysts show premature transcription at the 4-cell stage in maternal Dnmt3a knockout embryos. These observations uncover an unexpected role for maternal DNMT3A activity in postfertilization epigenetic reprogramming and transcriptional silencing of the paternal genome.
INTRODUCTION
Male germ cell development in mammals is characterized by widespread de novo DNA methylation (DNAme) and compaction of DNA via histone-to-protamine exchange1. As DNAme is largely maintained throughout spermatogenesis, the genomes of mature spermatozoa harbor characteristically high levels of DNAme2. Following fertilization, the paternal genome undergoes another profound change in chromatin state, including replacement of protamines with histones and a global reduction in DNAme before the first S-phase3,4. Subsequently, DNAme levels on both parental genomes are progressively reduced with each DNA replication cycle5. While passive demethylation in the early embryo is likely explained by sequestration of the maintenance DNA methyltransferase DNMT1 in the cytoplasm6–8, the mechanism of active demethylation remains controversial. Indeed, while TET3-mediated oxidation followed by base excision repair has been implicated in this process, a TET-independent mechanism is also clearly involved9–15. Regardless, whole-genome bisulphite sequencing (WGBS) analyses reveal that DNAme levels on both parental genomes reach a low point in inner cell mass (ICM) cells of embryonic day 3.5 (E3.5) mouse blastocysts, followed by widespread de novo DNAme during post-implantation development16–18. This wave of genome-wide demethylation followed by remethylation is conserved in human embryonic development, albeit with slower kinetics19–21. Notably, disruption of the machinery required for the establishment or maintenance of DNAme result in infertility and/or embryonic lethality in mice, revealing the importance of DNAme homeostasis in early mammalian development7,8,13,22–27.
CpG islands (CGIs), short stretches of CpG-rich regions, are an exception to the widespread DNAme observed in spermatozoa. Indeed, the vast majority of CGIs, which encompass the promoter regions of most housekeeping genes, are hypomethylated in mature male and female germ cells, as well as in early embryonic development18,28–33. In addition, CGIs retain nucleosomes in spermatozoa, foregoing the exchange for protamines28–30. These retained nucleosomes include canonical H3 or its variant H3.3, which are enriched for di- and/or tri-methylation on lysine 4 (H3K4me2/3)30,34,35. Although the extent of histone post-translational modification (PTM) maintenance following fertilization is controversial34,36,37, the retention and/or rapid deposition of H3K4 methylation at CGI promoters may protect these regions against de novo DNAme38 in the developing male germline as well as the early embryo. Indeed, most CGI promoters are enriched for H3K4me3 and remain hypomethylated on both parental genomes throughout early embryonic development and in adult tissues16,39. H3K4me2/3 also likely facilitate the initiation of transcription from the paternal genome during zygotic gene activation (ZGA)28,34, which marks the transition between oocyte and embryonic transcriptional programmes20. As in sperm, CGIs in oocytes are generally hypomethylated and harbor nucleosomes enriched for H3K4me336 and/or H3K27me340,41. However, a subset of CGIs, are de novo methylated in growing oocytes by DNMT3A, which is highly expressed in oocytes42–44. Paradoxically, despite widespread DNAme loss from the paternal genome in mouse zygotes, maternal DNMT3A is also clearly detected in the paternal pronucleus at this stage14,27 and ongoing de novo DNAme is required for maintaining paternal allele DNAme of the paternally imprinted H19 locus in early embryos45. Further evidence that the zygotic paternal genome is subject to de novo DNAme was demonstrated in a recent study employing immunofluorescence (IF) and ultrasensitive liquid chromatography/mass spectrometry14. However, the genomic regions subject to such paternal DNAme acquisition (PDA) in the early embryo and the relevance of this phenomenon to transcriptional regulation of the paternal genome has not been systematically addressed.
To determine which loci gain DNAme immediately following fertilization, we carried out an allele-specific analysis of WGBS data from 2-cell (2C) F1 hybrid embryos16 and identified specific genomic regions, including CGI promoters, that show PDA. Corroborating these enigmatic findings, we observe PDA of an overlapping set of CGI promoters in androgenetic but not in parthenogenetic blastocysts. Allele-specific analysis of ChIP-seq data from 2C embryos reveals that PDA is accompanied by loss of H3K4me3 over the same regions, indicating that such DNAme may inhibit transcription from the paternal allele in early embryonic development. Indeed, we show that PDA is lost in the absence of maternal DNMT3A and a subset of hypomethylated genes are concomitantly upregulated specifically from the paternal allele in the 4C embryo. Taken together, these experiments reveal that beyond its role in maternal imprinting, DNMT3A methylates a subset of genes on the paternal genome in the zygote, inhibiting their expression in preimplantation development.
RESULTS
The paternal genome undergoes de novo DNAme following fertilization
To trace parent-specific DNAme levels following fertilization and throughout embryonic development with single-nucleotide resolution, we first processed publicly available WGBS data derived from primordial germ cells (PGCs), spermatozoa and MII oocytes2,31,46. We then applied our recently developed allele-specific pipeline MEA47 to WGBS data generated from 2C (55X coverage) as well as 4C, ICM, E6.5 and E7.5 F1 hybrid embryos16. This integrated analysis yielded female/maternal and male/paternal DNAme profiles through fertilization and early development (Fig. S1a-b). Consistent with previous IF data3,4, comparison of DNAme levels in mature gametes and 2C embryos reveals an overall decrease on the maternal and paternal genomes of 8% and 43%, respectively (Fig. S1c). Surprisingly however, coincident with global DNAme loss across the paternal genome, robust DNAme gain (defined as an increase of ≥30%) was detected at ~4% of all hypomethylated regions (≤20%) in sperm, totalling 1.4 Mbp of the mappable genome (Fig. 1a). De novo DNAme of the paternal genome is consistent with the rapid translocation of maternal DNMT3A into the zygotic paternal pronucleus (Fig. S1d), as reported previously14,27. Remarkably, regions showing clear evidence of paternal DNAme acquisition (PDA) are enriched over annotated genic transcription start sites (TSSs) (χ2 test p=1.3E-211 Fig. 1b), particularly over CpG rich promoters (χ2 test p=0.002, Fig. 1c). Furthermore, a subset of TSSs showing PDA maintain such DNAme on the paternal genome to the blastocyst stage (Fig. 1d). While PDA is not restricted to CpG-rich regions, we focused our analyses on CGI promoters, as DNAme is reported to have the strongest impact on transcription of this class of promoters48,49.
To generate a curated list of CpG-rich hypomethylated TSSs in sperm, we categorized promoters by CpG density (high, intermediate and low), as described for the human genome49. As expected, DNAme levels and CpG density are anti-correlated (Fig. S2a). To minimize the potential confounding effects of strain-specific differences when comparing DNAme levels of parental genomes, we next determined the variation in DNAme levels in C57BL/6J versus DBA/2J sperm using published WGBS datasets2,16. Methylation profiles from these strains show a strong correlation (r2=0.98, Fig. S2b), with 20,163 promoters showing consistent DNAme levels (high or low) in both strains. Promoters showing strain-specific hypomethylation (185 in DBA/2J and 82 in C57BL/6J) were excluded from further analysis. Taking advantage of the fact that DNAme and H3K4me3 are anticorrelated in soma and germ cells, we further refined our list of CGI promoter TSSs using publicly available H3K4me3 ChIP-seq data from C57BL/6J sperm30. As expected, H3K4me3 enrichment levels show a positive correlation with CpG density and negative correlation with DNAme (Fig. S2a). Selecting TSSs that show H3K4me3-enrichment (RPKM ≥1) and intermediate to high CpG density (CGI promoters, CpG ratio ≥0.12) yielded a list of 12,253 CGI promoters, the vast majority of which are hypomethylated in sperm of both strains (mean DNAme; C57BL/6J=2.1%, DBA/2J=2.0%). Of these, 4,434 harbor a SNV or INDEL and had sufficient WGBS coverage (5X allele-specific read coverage over ≥2 CpGs separated by >1 sequencing read length) to score DNAme levels in both sperm and the paternal genome of C57BL/6J x DBA/2J F1 2C embryos (Fig. 1e). To unequivocally identify targets of post-fertilization de novo DNAme, we focussed on these CGI promoters.
While the vast majority of CGI promoters hypomethylated in sperm maintain low paternal DNAme levels in 2C embryos, 63 showed clear evidence of PDA (defined as a ≥30% gain, Fig. 1f and Supplemental Table 1). Notably, lower levels of H3K4me3 in sperm are unlikely to explain their propensity to gain DNAme, as the distribution of H3K4me3 levels in sperm was not significantly different between these CGIs and those that showed no gain in DNAme (p=0.46, Fig. 1g). However, relative to CGIs that remain unmethylated, PDA CGI promoters show a significantly greater decrease of H3K4me3 levels over the paternal allele in 2C embryos (p=2.25E-5). Though we cannot discriminate between active demethylation of H3K4 and histone H3 turnover, these results reveal that de novo DNAme of CGIs on the paternal genome is generally accompanied by a reduction of H3K4me3. For example, Tuba3a, Gdap2 and Bpi gain DNAme across 28, 58 and 7 CpGs proximal to their TSSs (+/-300bp), respectively, coincident with loss of H3K4me3 on the paternal allele (Fig. 1h), while the control gene Ufc1 displays persistent DNA hypomethylation and H3K4me3 enrichment on the paternal genome both pre- and post-fertilization (Fig. 1i). Surprisingly, only 11 of the PDA genes are methylated (≥20% DNAme) in MII oocytes and none gain DNAme on the maternal genome in 2C embryos (Fig. S1e). In contrast, maternally imprinted genes, such as Impact and Snurf, show maternal allele-specific DNA hypermethylation in the ICM and paternal allele-specific enrichment of H3K4me3 throughout early embryonic development, as expected (Fig. S2c). Taken together, these analyses reveal that a specific subset of CGI promoters are de novo DNA methylated exclusively on the paternal genome following fertilization, concomitant with reduced H3K4me3.
DNAme at many PDA loci is maintained through the blastocyst stage
To determine whether DNAme at PDA sites persists through the wave of global DNAme erasure, we scored paternal DNAme levels at these loci using WGBS data from F1 hybrid ICM cells16. Of 63 PDA loci, 53 had sufficient allele-specific WGBS coverage to ascertain paternal DNAme levels in ICM cells. Relative to CGI promoters that remain hypomethylated following fertilization, those that show PDA retain higher DNAme on the paternal allele in ICM cells (p=4.97E-6, Fig. 2a), albeit at lower levels than observed in 2C embryos. In contrast, 19 CGI promoters that show PDA, including Gdap2 (Fig. 2b), are hypomethylated (mean <5%) in blastocysts (Supplemental Table 1). Thus, while DNAme at a subset of CGI promoters showing PDA is transient, others either resist DNA demethylation or are reiteratively de novo methylated in early embryonic development.
To confirm the persistence of paternal allele-specific DNAme and expand upon the number of loci at which PDA is likely occurring in the early embryo, we isolated genomic DNA from isogenic (C57BL/6NJcl) androgenetic blastocysts, which contain only paternally inherited genomes, and conducted WGBS. Compared to CGI promoters that remain hypomethylated in 2C embryos, those that show PDA exhibited a significantly greater level of DNAme in such bipaternal blastocysts (p=9.30E-8, Fig. 2a). Furthermore, the majority of CGI promoters that show persistence of DNAme (≥20%) on the paternal allele in ICM cells, including 8 PDA genes, show ≥10% DNAme in androgenetic blastocysts (Fig. S2d). In contrast, analysis of our previously published WGBS data from parthenogenetic blastocysts43, in which both genomes are maternally derived, reveals that DNAme remains low at all of the CGI promoters showing zygotic PDA (Fig. 2a), with the exception of 6 of the 11 that are already hypermethylated in MII oocytes (Supplemental Table 1). Thus, loci showing PDA are de novo methylated in the early embryo exclusively when at least one paternal genome is present.
Given that androgenetic and parthenogenetic blastocysts are uniparental, we were able to extend our parental genome-specific DNAme analysis from 18 to 90% of all annotated autosomal CGI promoters. As expected, maternally imprinted CGI promoters, such as Peg10 and Zdbf2, which are hypermethylated exclusively on the maternal allele in normal embryos, remain hypermethylated in parthenogenetic blastocysts (Fig. 2c). However, only one CGI promoter (Ccdc114) shows a ≥20% DNAme gain in these cells relative to germinal vesicle (GV) oocytes. In contrast, 28 CGI promoters show such a gain in androgenetic blastocysts relative to sperm, confirming that the paternal genome is the preferred target for such post-fertilization de novo
DNAme (Fig. 2d and Supplemental Table 1). While 17 of these loci (including Thy1) do not harbor a genetic variant and could therefore not be assessed in the F1 hybrid dataset, six, including Tuba3a, Bpi, Them7, Shisa7, Syn3 and A230077H06Rik, were also identified as PDA genes in our allele-specific analysis of F1 hybrid embryos (Fig. 2e) and four (H1fnt, Dbx2, Tbx4 and Prss39) showed a gain in DNAme of 9-25%, just below our original threshold of >30%. These results indicate that PDA occurs independent of DBA/2J-specific variants and is thus a bona fide parent-of-origin effect at these loci.
Relationship between histone PTMs and PDA
To determine whether promoter regions showing PDA share a common DNA motif that may render them susceptible to de novo DNAme, we performed motif discovery using HOMER50 and MEME51. However, we did not detect any common DNA motif around the TSSs (+/-300 bp) of genes that show PDA. Therefore, we focussed on the relationship between histone PTMs and paternal DNAme acquisition and/or subsequent DNAme maintenance at these sites. We analyzed published H3K4me234, H3K4me330,36, H3K9me317, H3K27me330,40 and H3K36me337 ChIP-seq data from sperm, oocytes, zygote (1C), 2C and ICM cells using ChromHMM52. No single histone PTM or combination thereof in sperm predicted PDA at CGI promoters versus those that remain hypomethylated (Fig. S3a-b). However, a striking enrichment of H3K9me3 was observed in the zygote and 2C stage at PDA sites (Fig. S3b) and those that show persistence of DNAme to the ICM show an even greater enrichment of H3K9me3 in the zygote and 2C embryo (Fig. S3c). Indeed, the paternal allele of many CGI promoters show a positive association between the levels of H3K9me3 at the 2C stage and DNAme in the ICM (Fig. S3d), including that of the PDA gene Tuba3a (Fig. S3d-e). Thus, this PTM may protect regions showing PDA against loss of paternal DNAme in the preimplantation embryo, consistent with previous reports indicating that H3K9me3 plays a role in promoting DNMT1-dependent maintenance of DNAme53,54.
Most PDA target genes are expressed during spermatogenesis and silenced in the early embryo
To determine whether PDA is associated with transcriptional inactivation, we analyzed existing RNA sequencing (RNA-seq) datasets from multiple stages in spermatogenesis as well as F1 hybrid preimplantation embryos55,56. While 59 of the 63 genes that show PDA are expressed during at least one stage of spermatogenesis, only 23 (including Tuba3a and Gdap2) are transcribed from the paternal allele in the early embryo (Fig. 3a). Nevertheless, DNAme persists at a subset of these genes through the blastocyst stage, albeit at intermediate levels, indicating that promoter DNAme status per se is not predictive of transcription from the paternal allele in the blastocyst.
A similar analysis of the relationship between DNAme and expression in GV oocytes revealed that 57 of the 63 PDA loci are hypomethylated at their promoters. Surprisingly, only 17 of these hypomethylated genes, including Tuba3a and Gdap2, are transcribed at this stage (Fig. 3b-c). To determine whether the inactive genes harbor histone marks associated with transcriptional repression, we integrated previously published H3K27me3 and H3K9me3 ChIP-seq datasets derived from oocytes and F1 hybrid embryos17,40. Consistent with a role for H3K9me3 in promoting DNAme maintenance, all 6 hypermethylated PDA loci are enriched for this histone PTM in oocytes (Fig. S4a-b). In contrast, 23 of the 40 silent hypomethylated CGI promoters are embedded within H3K27me3-enriched domains (TSS +/-10kb, RPKM ≥0.5), 17 of which are maintained on the maternal allele at least to the late 2C stage (Fig. 3d). The TSS of Bpi for example is embedded within an extended H3K27me3 domain in oocytes which persists to the 2C stage (Fig. 3e). Notably, H3K27me3 was recently implicated in transcriptional silencing of genes subject to non-canonical maternal imprinting in the mouse41,57. These results reveal that at the 2C stage, the paternal and maternal alleles of a subset of PDA loci are distinctly marked by DNAme and H3K27me3, respectively.
Maternal DNMT3A is required for PDA
As DNMT3A is required for de novo DNAme in the female germline31 and maternal DNMT3A persists in the zygote (Fig. S1d), we next wished to determine whether maternal DNMT3A is responsible for PDA. We crossed oocyte-specific homozygous Dnmt3a knock-out (matKO) C57BL/6J females with wild-type (WT) DBA/2J males and performed WGBS on F1 hybrids at the early-mid 2C stage (Fig. 4a, 5X mean sequencing coverage). As expected, global maternal DNAme levels in 2C matKO embryos mirror those in Dnmt3a matKO GV oocytes (Fig. S5a). Furthermore, while the paternal gametic differentially methylated regions (gDMRs) H19, Dlk1-Gtl2 and Rasgrf1 show no decrease, DNAme at maternal gDMRs is dramatically reduced in matKO relative to control embryos (Fig. 4b). Importantly, a positive correlation was observed when comparing paternal DNAme levels of CGI promoters with sufficient allele-specific coverage in our control dataset with published 2C WGBS data16, with the majority of PDA genes consistently showing relatively high DNAme on the paternal allele (Fig. S5b). In the absence of maternal DNMT3A however, DNAme is lost on the paternal allele of all 23 CGI promoters showing PDA for which allelic methylation can be deduced (Fig. 4c). At the Tuba3a, Gdap2 and Snx1 promoters for example, PDA is lost in matKO embryos across all CpGs in the promoter region (Fig. 4d). While the remaining 40 PDA loci lack allele-specific coverage in our matKO samples, analysis of total DNAme levels reveals that 33 are clearly hypomethylated (<4%) (Supplemental Table 1), as shown for Bpi (Fig. 4d). Taken together, these results demonstrate that DNAme acquisition on the paternal allele immediately following fertilization is dependent upon maternal DNMT3A.
Loss of PDA results in ectopic expression from the paternal allele
Hypermethylation of CGI promoters is associated with transcriptional silencing48,49. To determine whether DNAme of genes showing PDA impacts their expression specifically from the paternal allele, we conducted strand-specific RNA-seq on early-mid 2C as well as 4C and blastocyst-stage F1 matKO embryos (Fig. 5a and Fig. S6a). A strong correlation was observed between matKO and WT 2C, 4C and blastocyst-stage embryos as well as previously published WT transcriptomes of the same developmental stages (Fig. S6b), indicating that maternal depletion of DNMT3A does not disrupt global transcriptional programming. This is consistent with previous observations that Dnmt3a matKO embryos develop normally until E9.526,58. We next determined whether genes known to be regulated by maternally established genomic imprints show loss of imprinting in Dnmt3a matKO embryos. Consistent with their loss of DNAme (Fig. 4b), Mcts2, Plagl1, Snurf, Peg10 & Zdbf2 imprinted genes were significantly upregulated (≥2-fold change, Wald Chi-squared test, Benjamini-Hochberg adjusted p-value ≤0.1) from the maternal allele (Fig. S6c-e). Thus, DNMT3A expression in the oocyte is required for maternal allele-specific transcriptional silencing of a subset of genes in the preimplantation embryo.
A similar analysis of genes upregulated from the paternal allele in 2C matKO embryos yielded only Gdap2, a PDA gene, as significantly upregulated (Fig. 5b-c). Further, of the 16 significantly upregulated genes in 4C matKO embryos, four: Gdap2, Snx1, Tuba3a and Plbd1, are PDA genes. In contrast, none of the 15 genes upregulated in ICM are PDA genes and thus likely represent either loci that are methylated post-fertilization on distal regulatory elements or indirect effects of maternal DNMT3A loss. Indeed, 5 of these genes are also significantly upregulated from the maternal allele (Supplemental Table 1). Importantly, transcription of all upregulated PDA genes initiates from the aberrantly hypomethylated CGI promoter, excluding alternative promoter usage as an explanation for the increased expression from the paternal allele (Fig. 5c-d). Furthermore, no significant upregulation of PDA genes was observed from the maternal allele, consistent with DNAme-independent silencing at this stage (Fig. 3d), or when total (allele-agnostic) transcript levels were analyzed (Fig. S7a-c). Thus, upregulation of PDA genes occurs exclusively from the paternal allele, raising the question, can expression data be exploited to identify additional PDA genes?
Due to the density of naturally occurring polymorphisms and depth of WGBS sequencing coverage, paternal DNAme dynamics could be measured in our earlier F1 hybrid analysis over only 4,434 of the 12,253 filtered autosomal CGI promoters (Fig. 1e). Of the additional 7,724 autosomal genes with CGI promoters that include at least 1 exonic genetic variant between parental strains and are expressed from the paternal allele in our RNA-seq data, 5 were significantly upregulated from the paternal genome in matKO 4C embryos, including Npm3, Eif3b, 2610524H06Rik, Crk & Pim1 (Fig. 5b-c). Importantly, as for bona fide PDA loci, none of these genes show a change in expression from the maternal allele (Fig. S7b,d), nor are they upregulated from the paternal allele in matKO ICM (Fig. 5b-c). Furthermore, analysis of total DNAme levels clearly shows that these loci are methylated in WT but not in matKO 2C embryos, indicating that these CGI promoters are direct targets of maternal DNMT3A (Fig. 5e). While the lack of genetic variants precludes the measurement of allele-specific DNAme over these regions, analysis of allele-agnostic DNAme levels in WT 2C embryos revealed that 4 of these 5 CGI promoters show a ≥18% gain in DNAme relative to their methylation state in sperm and oocyte (Supplemental Table 1). Thus, in addition to the PDA genes described above, these 4 loci are likely de novo methylated on the paternal allele in 2C embryos, and repressed by this mark in 4C embryos. Taken together, these results reveal that the absence of maternal DNMT3A in the early embryo leads to failure of de novo DNAme on the paternal allele of a subset of genes and, in turn, their ectopic expression.
DISCUSSION
Using allele-specific analyses of early embryos, we determined that 4% of all hypomethylated regions in sperm, including at least 63 CGI promoters, are de novo methylated on the paternal genome by the 2C stage. An Independent analysis of androgenetic blastocysts revealed 86 CGI promoters that show a ≥10% gain in DNAme relative to sperm, 15 of which overlap with the PDA genes identified in normal 2C embryos (Supplemental Table 1). These observations are particularly surprising, given that the hypermethylated sperm genome is globally demethylated in the mouse zygote. Indeed, following polyspermic fertilization, where methylation of the maternal genome remains relatively constant, up to five paternal genomes are demethylated in the zygote4. Although zygotic de novo DNAme of the maternal genome has been reported for the TKZ751 transgene and Igf259, ETn retroelements60 and H3K9me2-enriched regions61, to our knowledge, this is the first report to characterize the specific regions of the paternal genome subject to de novo DNA methylation in the mouse zygote beyond the H19 gDMR45,62,63.
To measure DNAme and chromatin dynamics at an allele-specific level in the early embryo, earlier studies relied on IF-based assays, which are inherently of low resolution and therefore uninformative with respect to specific genomic loci3,4,10. Further, while such studies revealed chromosome-scale dynamics in the early embryo, dissecting the interplay between local DNAme, histone PTMs and transcription is not possible using IF. Our integrated allele-specific analysis reveals that loss of H3K4me3 and PDA occur shortly following fertilization, consistent with the observation that DNMT3A recognizes the unmethylated state of H3K438,64. Notably, persistence of H3K4 methylation on the paternal genome was previously reported to play an important role in gene regulation in 2C embryos34. Our results reveal that at a distinct subset of loci, loss of H3K4 methylation may be a pre-requisite for de novo DNAme, and in turn transcriptional silencing.
How DNMT3A is targeted to PDA loci remains to be determined. While we did not uncover any common DNA motifs, it is possible that multiple different DNA binding factors bind to such regions to promote PDA. Interestingly, all but 3 PDA sites concomitantly gain H3K9me3 (RPKM ≥1) in the zygote, raising the possibility that this mark may promote and/or maintain acquired DNAme. As KRAB-ZFPs have been shown to promote H3K9me3 deposition and potentially de novo DNAme at gDMRs65–67, repetitive elements68 and genic promoters69, binding of yet to be characterized KRAB-ZFPs, in complex with TRIM28, may be responsible for sequence-specific targeting of DNMT3A to regions showing PDA. Alternatively, previous studies revealed that a specific set of CpG-rich germline gene promoters harbor E2F6 and E-box motifs that promote binding of the non-canonical PRC1 complex PRC1.6 and de novo DNAme in post-implantation embryos70,71. Furthermore, such de novo DNAme occurs in conjunction with H3K9me3 acquisition72,73. However, de novo DNAme at these germline gene promoters is DNMT3B-dependent and the E2F6 motif is present in the promoter region of only 4 of the loci showing PDA. Additional studies will be required to determine whether specific transcription factors and/or chromatin features are required for de novo DNA methylation of the paternal genome.
Dnmt3a maternal KO embryos die during post-implantation development at around E9.5-10.526,58. While it is tempting to speculate that aberrant expression of PDA genes from the paternal allele plays a role, our temporal analysis reveals that this is a transient phenomenon, with mRNA levels of these genes indistinguishable from wild type by the blastocyst stage. Alternatively, aberrant expression of imprinted genes as a consequence of failure of de novo DNAme in the oocyte may be responsible for such embryonic lethality23,74. However, we find that several maternally imprinted alleles are already expressed from the hypomethylated maternal allele in Dnmt3a matKO ICM cells (~E3.5). Thus, as for genes showing PDA, aberrant expression of at least a subset of maternally imprinted genes occurs well before the gross phenotypic effects are manifest. In summary, this study reveals that maternal DNMT3A is required for de novo DNAme of specific regions on the paternal genome immediately following fertilization, and in turn silencing of a subset of methylated genes on the paternal allele in early mouse embryonic development. Whether maternal DNMT3A acts on the paternal genome following fertilization in other mammals, and what effect such DNAme has on transcriptional regulation of target genes remains to be determined.
MATERIALS AND METHODS
Ethical approval for animal work
All animal experiments were performed under the ethical guidelines of Kyushu University and Tokyo University of Agriculture.
Isolation of androgenetic blastocyst
Diploid androgenones were prepared as previously described75. Oocyte and spermatozoa were isolated from B6D2F1/Jcl and C57BL/6NJcl mice (Clea Japan, Tokyo, Japan), respectively. Briefly, enucleated oocytes were in vitro fertilized and zygotes with two male pronuclei were cultured for 4 days in KSOM medium at 37°C and 5% CO276. 5 blastocyst pools were collected in triplicate for WGBS library construction.
Dnmt3a maternal KO embryo culture and genotyping
Dnmt3a KO oocytes were generated using Dnmt3a2lox and Zp3-cre C57BL/6J mice as described previously26,77. Superovulation was induced using PMSG/hCG and MII oocytes were collected from oviducts. Dnmt3a2lox;Zp3-cre MII oocytes were artificially inseminated with DBA/2J spermatozoa. Cumulus cells were removed using hyaluronidase after insemination and embryos were cultured in KSOM at 37°C and 5% CO2. Early-mid 2C embryos were collected at 22 hours (WGBS) and 24 hours (RNA-seq), 4C embryos at 36 hours and blastocysts at 96 hours. Zona pellucida and polar bodies of 2C embryos were removed (WGBS). ICM cells were purified by immunodissection using anti-mouse IgG (Cedarlane) and guinea pig complement (Rockland)78. Genotyping was performed by PCR using primers for Dnmt3a (CTGTGGCATCTCAGGGTGATGAGCA and GCAAACAGACCCAACATGGAACCCT) and the Zp3-cre transgene (GCAGAACCTGAAGATGTTCGCGAT and AGGTATCTCTGACCAGAGTCATCC).
DNMT3A immunofluorescence
Dnmt3a2lox;Zp3-cre females were mated with JF1 males and IF was performed on one-cell zygotes. DNMT3A was detected using the IMG-268 IMGENEX antibody, and DNA was counterstained using propidium iodide, as described previously27.
WGBS and RNA-seq library construction and sequencing
Lysates of androgenetic blastocysts were spiked with 0.1 ng lambda phage DNA and subjected to WGBS library construction according to the PBAT protocol for single-read sequencing46. DNA from 20-30 pooled 2C embryos per replicate was purified and spiked with 1% unmethylated lambda phage DNA, and WGBS libraries were generated by PBAT with 4 cycles of library amplification61. All WGBS libraries had >99% bisulphite conversion rates. Total RNA was extracted from 20-40 pooled 2C embryos, 5-10 4C embryos and 2-7 blastocysts per replicate using Trizol reagent. Strand-specific RNA-seq libraries were generated using NEBNext: rRNA Depletion Kit, RNA First Strand Synthesis Module, Ultra Directional RNA Second Strand Synthesis Module, and Ultra II DNA Library Prep Kit. Libraries were sequenced on HiSeq 1500 or HiSeq 2500 (WGBS: HCS v2.2.68 and RTA v1.18.66.3)79. See Supplemental Table 2 for full sequencing and alignment statistics.
NGS data processing
Reads were trimmed using Trimmomatic v0.3280 and processed for total and allele-specific alignments using MEA v1.047 using default parameters and the mm10 reference genome. 4 bases were removed from the 5’ end of PBAT sequences. All publicly available NGS data (Supplemental Table 2) was reprocessed as above, with the exception of WGBS datasets from sperm2, oocytes31, parthenones43 and primordial germ cells46, which were previously processed and filtered using identical parameters as in this study.
WGBS data analysis
DNAme levels over individual CpGs with ≥5x coverage (including allele-specific) were scored, with the exception of allele-specific alignments of WGBS datasets generated in this study, for which a ≥1x allele-specific read coverage cutoff was used to score methylation status. DNAme levels were calculated over CGI promoters using Bedops v2.4.2781 and visualized using VisRseq v0.9.1282. Only CGI promoters that overlapped at least 2 informative CpGs separated by the maximum sequencing read length of the library were kept. Genome-wide 2- and 20kb bins were generated using Bedtools, and bins covered by at least 4 CpGs separated by over 1 read length in each dataset were used, and a random subset of 1,000 bins were visualized as parallel coordinate plots using VisRseq. Genome-wide 600bp bins with 100bp overlap were used to measure paternal allele DNAme dynamics in sperm and F1 hybrid 2C embryos. Bins covered by at least 2 CpGs separated by over 1 read length in each dataset were kept. Bins showing <20% DNAme in sperm and a ≥30% gain in 2C embryos were scored as showing PDA. Overlapping PDA regions were subsequently merged using Bedtools. NCBI RefSeq (default in VisRseq) and Ensembl Regulatory features (release 81) annotations were used to identify PDA regions that overlapped TSSs, gene bodies and enhancers.
ChIP-seq data analysis
Raw sequencing reads were reprocessed as described above into total and allele-specific genomic tracks. RPKM values were calculated over TSSs (+/-300bp) using VisRseq on the basis of normalized genomic tracks. ChromHMM v1.1252 was employed to define distinct chromatin states (LearnModel, k=6) on the basis of filtered BAM files (BinarizeBam) using default parameters.
RNA-seq data processing
Raw sequencing reads were reprocessed as described above into total and allele-specific genomic tracks. Gene expression (RPKM) values over genic exons were calculated using VisRseq (NCBI Refseq). Paternal RPKM values for each gene showing PDA was then plotted on a parallel-coordinate plot using VisRseq. Oocyte CGI promoter expression (RPKM) was calculated over TSSs +/-300bp and normalized to total aligned reads. Correlograms were generated using Morpheus (https://software.broadinstitute.org/morpheus) on the basis of log2 transformed values. For genome browser visualization, biological replicates were merged and total (alleleagnostic) and allele-specific genomic tracks were organized into UCSC Track Hubs as described previously47. Total, paternal and maternal-specific changes in gene expression were calculated using DESeq2 v1.26.0 with default parameters (FDR=10%)83. Genes with a ≥2-fold change in expression and a Benjamini-Hochberg adjusted p-value ≤ 0.1 were considered differentially expressed. Transcription initiation sites for Dnmt3a matKO and wild-type embryos were determined using StringTie v1.3.584.
Motif analysis
Known and de novo DNA motif discovery was conducted using HOMER findMotifs.pl v4.11.150 and the MEME suite51. The sequences of CGI promoters showing PDA were input in fasta format, default parameters were used and CGIs showing persistent paternal hypomethylation (n=4,315) were used as background sequences. Both C57BL/6J and DBA/2J sequences were tested.
Statistical tests
T-tests of two samples assuming unequal variances were performed when comparing the distribution of DNAme or H3K4me3 levels between CGI promoters that show PDA or persistent hypomethylation. Chi-squared tests were performed when comparing categorical data.
Data availability
Datasets generated in this study have been deposited in GEO under the accession number GSE141877. See Supplemental Table 2 or the full list of data analyzed for this study.
AUTHOR CONTRIBUTIONS
J.R.A. and M.C.L. conceived the project and wrote the paper. W.K.A.U, K.T and H.S. carried out the experiments on Dnmt3a matKO mice. H.K. performed the uniparental embryo experiments. R.H. and H.S. performed the zygotic DNMT3A IF analysis. J.R.A. performed bioinformatic analysis with the assistance of J.B.D and A.B.B.
ACKNOWLEDGEMENTS
We are grateful to Dr. Tomohiro Kono (Tokyo University of Agriculture) and Dr. Takuya Wakai (Okayama University) for technical assistance in mouse androgenone collection. We thank J. Oishi and T. Akinaga (Kyushu University) for their assistance with PBAT sequencing and data collection, Alex Boiselle for help with parallel coordinate plots, and Tiffany Leung for help with DESeq2. We thank members of the Lorincz lab for helpful discussions, and Louis Lefebvre and Sanne Janssen for reading the manuscript. Financial support was from the Canadian Institutes of Health Research (PJT-153049) and the Natural Sciences and Engineering Research Council of Canada (RGPIN-2015-05228) to M.C.L. and a JSPS KAKENHI grant to H.S. (JP18H05214). J.R.A. was a recipient of an NSERC Postgraduate Scholarships-Doctoral Program award (PGSD3–476000-2015) and a Killam Doctoral Scholarship.
REFERENCES
- 1.↵
- 2.↵
- 3.↵
- 4.↵
- 5.↵
- 6.↵
- 7.↵
- 8.↵
- 9.↵
- 10.↵
- 11.
- 12.
- 13.↵
- 14.↵
- 15.↵
- 16.↵
- 17.↵
- 18.↵
- 19.↵
- 20.↵
- 21.↵
- 22.↵
- 23.↵
- 24.
- 25.
- 26.↵
- 27.↵
- 28.↵
- 29.
- 30.↵
- 31.↵
- 32.
- 33.↵
- 34.↵
- 35.↵
- 36.↵
- 37.↵
- 38.↵
- 39.↵
- 40.↵
- 41.↵
- 42.↵
- 43.↵
- 44.↵
- 45.↵
- 46.↵
- 47.↵
- 48.↵
- 49.↵
- 50.↵
- 51.↵
- 52.↵
- 53.↵
- 54.↵
- 55.↵
- 56.↵
- 57.↵
- 58.↵
- 59.↵
- 60.↵
- 61.↵
- 62.↵
- 63.↵
- 64.↵
- 65.↵
- 66.
- 67.↵
- 68.↵
- 69.↵
- 70.↵
- 71.↵
- 72.↵
- 73.↵
- 74.↵
- 75.↵
- 76.↵
- 77.↵
- 78.↵
- 79.↵
- 80.↵
- 81.↵
- 82.↵
- 83.↵
- 84.↵